Incidental Mutation 'R9039:Olfr1228'
ID 687590
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Name olfactory receptor 1228
Synonyms MOR233-1, GA_x6K02T2Q125-50696209-50695274
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89247964-89254062 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89249201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 152 (F152L)
Ref Sequence ENSEMBL: ENSMUSP00000150878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
AlphaFold Q8VGM9
Predicted Effect probably benign
Transcript: ENSMUST00000190757
AA Change: F164L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: F164L

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215447
AA Change: F152L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216392
AA Change: F152L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,167,075 V692A possibly damaging Het
Aco2 C G 15: 81,872,419 probably benign Het
Adcy10 T C 1: 165,518,345 I321T probably damaging Het
Agbl2 C T 2: 90,815,386 T821I probably benign Het
Alpk1 A G 3: 127,679,543 L937P probably damaging Het
Atp5b A G 10: 128,083,898 D45G probably benign Het
C8a C T 4: 104,822,003 R530H probably benign Het
Cacna1s T C 1: 136,088,319 S694P probably benign Het
Cdca7 T A 2: 72,482,512 D162E probably benign Het
Cep78 G T 19: 15,959,543 Q600K probably benign Het
Col4a3bp C T 13: 96,543,209 P16S probably benign Het
Coq8b A C 7: 27,250,586 R363S probably benign Het
Cpne3 A T 4: 19,540,770 C202S probably damaging Het
Csmd3 G T 15: 47,619,912 probably benign Het
Cyp4a14 A T 4: 115,487,264 V468E probably damaging Het
Dchs1 A T 7: 105,756,008 D2442E probably benign Het
Dip2a T C 10: 76,327,719 Y49C probably benign Het
Dopey1 A G 9: 86,500,817 R268G probably damaging Het
Eid3 C T 10: 82,867,731 S342L possibly damaging Het
Ezh2 A G 6: 47,551,737 L296P possibly damaging Het
Fgfrl1 G C 5: 108,705,573 probably null Het
Flg2 A G 3: 93,203,592 R976G unknown Het
Fsip2 C A 2: 82,998,201 Q6781K probably benign Het
Gm7534 C A 4: 134,195,547 V492F probably damaging Het
Golga3 C T 5: 110,204,933 H857Y probably benign Het
Hmcn2 T A 2: 31,354,634 V701E probably damaging Het
Il21 A T 3: 37,232,453 I38N probably benign Het
Ip6k2 G T 9: 108,804,608 G246V probably damaging Het
Ipo13 T C 4: 117,900,988 Q726R probably damaging Het
Itsn1 A T 16: 91,906,770 N1521Y unknown Het
Kif2b A G 11: 91,576,305 V384A possibly damaging Het
L3mbtl1 G T 2: 162,966,068 R541L probably damaging Het
Lama3 T A 18: 12,481,063 C1296* probably null Het
Lars T C 18: 42,257,169 D11G probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Mmp27 C A 9: 7,581,249 F478L probably benign Het
Moxd1 T A 10: 24,279,353 probably benign Het
Naaa T A 5: 92,272,441 probably benign Het
Nav1 T A 1: 135,443,749 Q1746L unknown Het
Nedd9 T C 13: 41,318,508 Y165C probably damaging Het
Neurod1 T C 2: 79,454,376 Y221C probably damaging Het
Olfr1040 T C 2: 86,146,281 Y151C probably damaging Het
Olfr1154 T C 2: 87,903,563 T38A probably damaging Het
Olfr450 A T 6: 42,817,611 I47F probably damaging Het
Orm3 A G 4: 63,356,296 N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,526 P241S probably damaging Het
Ppp1r9a A G 6: 5,134,657 T949A probably benign Het
Prdx6 A T 1: 161,251,049 I23N probably damaging Het
Prkd3 A T 17: 78,972,574 V334E probably benign Het
Prr12 A T 7: 45,034,722 D1631E probably damaging Het
Ptpn22 A G 3: 103,912,235 probably benign Het
Pum2 T G 12: 8,744,430 D773E probably damaging Het
Sidt2 A G 9: 45,945,350 C451R probably benign Het
Slc37a2 A G 9: 37,237,362 S275P probably benign Het
Slmap G T 14: 26,533,364 N54K probably benign Het
Susd4 A G 1: 182,854,032 D146G probably benign Het
Tekt3 G A 11: 63,081,343 R275H possibly damaging Het
Tkfc A G 19: 10,596,248 L242P probably damaging Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Triqk A T 4: 12,980,490 D78V probably damaging Het
Trmo T C 4: 46,382,322 D258G probably benign Het
Tsc2 A G 17: 24,607,515 V920A probably benign Het
Tspan17 C T 13: 54,796,178 Q257* probably null Het
Tube1 T A 10: 39,135,021 F45I probably damaging Het
Vmn1r4 A G 6: 56,956,837 T109A possibly damaging Het
Vmn2r14 A T 5: 109,220,036 Y363* probably null Het
Zfp324 G T 7: 12,971,528 G548V probably benign Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 splice site probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 splice site probably null
R7548:Olfr1228 UTSW 2 89249086 missense probably benign 0.09
R8014:Olfr1228 UTSW 2 89248999 missense probably damaging 0.98
R8098:Olfr1228 UTSW 2 89249308 missense possibly damaging 0.95
R8280:Olfr1228 UTSW 2 89248890 missense probably damaging 0.98
R8554:Olfr1228 UTSW 2 89249251 missense possibly damaging 0.48
R8678:Olfr1228 UTSW 2 89249007 missense probably damaging 1.00
R8725:Olfr1228 UTSW 2 89249314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGATGCTGATAGACCCACTG -3'
(R):5'- CTGTCACCCCTAAGATGATGG -3'

Sequencing Primer
(F):5'- TGCTGATAGACCCACTGTTAGAAAAC -3'
(R):5'- TGTCACCCCTAAGATGATGGTAGAC -3'
Posted On 2021-11-19