Incidental Mutation 'R9039:Il21'
ID 687593
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Name interleukin 21
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 37222759-37232636 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37232453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 38 (I38N)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
AlphaFold Q9ES17
Predicted Effect probably benign
Transcript: ENSMUST00000029273
AA Change: I38N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: I38N

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161015
AA Change: I38N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: I38N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,167,075 V692A possibly damaging Het
Adcy10 T C 1: 165,518,345 I321T probably damaging Het
Agbl2 C T 2: 90,815,386 T821I probably benign Het
Alpk1 A G 3: 127,679,543 L937P probably damaging Het
Atp5b A G 10: 128,083,898 D45G probably benign Het
C8a C T 4: 104,822,003 R530H probably benign Het
Cacna1s T C 1: 136,088,319 S694P probably benign Het
Cdca7 T A 2: 72,482,512 D162E probably benign Het
Cep78 G T 19: 15,959,543 Q600K probably benign Het
Col4a3bp C T 13: 96,543,209 P16S probably benign Het
Coq8b A C 7: 27,250,586 R363S probably benign Het
Cpne3 A T 4: 19,540,770 C202S probably damaging Het
Cyp4a14 A T 4: 115,487,264 V468E probably damaging Het
Dchs1 A T 7: 105,756,008 D2442E probably benign Het
Dip2a T C 10: 76,327,719 Y49C probably benign Het
Dopey1 A G 9: 86,500,817 R268G probably damaging Het
Eid3 C T 10: 82,867,731 S342L possibly damaging Het
Ezh2 A G 6: 47,551,737 L296P possibly damaging Het
Fgfrl1 G C 5: 108,705,573 probably null Het
Flg2 A G 3: 93,203,592 R976G unknown Het
Fsip2 C A 2: 82,998,201 Q6781K probably benign Het
Gm7534 C A 4: 134,195,547 V492F probably damaging Het
Golga3 C T 5: 110,204,933 H857Y probably benign Het
Hmcn2 T A 2: 31,354,634 V701E probably damaging Het
Ip6k2 G T 9: 108,804,608 G246V probably damaging Het
Ipo13 T C 4: 117,900,988 Q726R probably damaging Het
Itsn1 A T 16: 91,906,770 N1521Y unknown Het
Kif2b A G 11: 91,576,305 V384A possibly damaging Het
L3mbtl1 G T 2: 162,966,068 R541L probably damaging Het
Lama3 T A 18: 12,481,063 C1296* probably null Het
Lars T C 18: 42,257,169 D11G probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Mmp27 C A 9: 7,581,249 F478L probably benign Het
Nav1 T A 1: 135,443,749 Q1746L unknown Het
Nedd9 T C 13: 41,318,508 Y165C probably damaging Het
Neurod1 T C 2: 79,454,376 Y221C probably damaging Het
Olfr1040 T C 2: 86,146,281 Y151C probably damaging Het
Olfr1154 T C 2: 87,903,563 T38A probably damaging Het
Olfr1228 G T 2: 89,249,201 F152L probably benign Het
Olfr450 A T 6: 42,817,611 I47F probably damaging Het
Orm3 A G 4: 63,356,296 N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,526 P241S probably damaging Het
Prdx6 A T 1: 161,251,049 I23N probably damaging Het
Prkd3 A T 17: 78,972,574 V334E probably benign Het
Prr12 A T 7: 45,034,722 D1631E probably damaging Het
Pum2 T G 12: 8,744,430 D773E probably damaging Het
Sidt2 A G 9: 45,945,350 C451R probably benign Het
Slc37a2 A G 9: 37,237,362 S275P probably benign Het
Slmap G T 14: 26,533,364 N54K probably benign Het
Susd4 A G 1: 182,854,032 D146G probably benign Het
Tekt3 G A 11: 63,081,343 R275H possibly damaging Het
Tkfc A G 19: 10,596,248 L242P probably damaging Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Triqk A T 4: 12,980,490 D78V probably damaging Het
Trmo T C 4: 46,382,322 D258G probably benign Het
Tsc2 A G 17: 24,607,515 V920A probably benign Het
Tspan17 C T 13: 54,796,178 Q257* probably null Het
Tube1 T A 10: 39,135,021 F45I probably damaging Het
Vmn1r4 A G 6: 56,956,837 T109A possibly damaging Het
Vmn2r14 A T 5: 109,220,036 Y363* probably null Het
Zfp324 G T 7: 12,971,528 G548V probably benign Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R0579:Il21 UTSW 3 37227774 missense possibly damaging 0.65
R1641:Il21 UTSW 3 37232532 missense probably benign 0.00
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1754:Il21 UTSW 3 37225525 missense possibly damaging 0.93
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4979:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R5641:Il21 UTSW 3 37227768 nonsense probably null
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
R9249:Il21 UTSW 3 37225528 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACCTTTACATCTTGTGGAGCTG -3'
(R):5'- TAAATAGGTAGCCGTAGCGACAAC -3'

Sequencing Primer
(F):5'- ACATCTTGTGGAGCTGATAGAAGTTC -3'
(R):5'- AACCTGTGCACAGTCAGGTTG -3'
Posted On 2021-11-19