Incidental Mutation 'R9039:Flg2'
ID687594
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R9039 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93203592 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 976 (R976G)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: R976G
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: R976G

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,167,075 V692A possibly damaging Het
Adcy10 T C 1: 165,518,345 I321T probably damaging Het
Agbl2 C T 2: 90,815,386 T821I probably benign Het
Alpk1 A G 3: 127,679,543 L937P probably damaging Het
Atp5b A G 10: 128,083,898 D45G probably benign Het
C8a C T 4: 104,822,003 R530H probably benign Het
Cacna1s T C 1: 136,088,319 S694P probably benign Het
Cdca7 T A 2: 72,482,512 D162E probably benign Het
Cep78 G T 19: 15,959,543 Q600K probably benign Het
Col4a3bp C T 13: 96,543,209 P16S probably benign Het
Coq8b A C 7: 27,250,586 R363S probably benign Het
Cpne3 A T 4: 19,540,770 C202S probably damaging Het
Cyp4a14 A T 4: 115,487,264 V468E probably damaging Het
Dchs1 A T 7: 105,756,008 D2442E probably benign Het
Dip2a T C 10: 76,327,719 Y49C probably benign Het
Dopey1 A G 9: 86,500,817 R268G probably damaging Het
Eid3 C T 10: 82,867,731 S342L possibly damaging Het
Ezh2 A G 6: 47,551,737 L296P possibly damaging Het
Fgfrl1 G C 5: 108,705,573 probably null Het
Fsip2 C A 2: 82,998,201 Q6781K probably benign Het
Gm7534 C A 4: 134,195,547 V492F probably damaging Het
Golga3 C T 5: 110,204,933 H857Y probably benign Het
Hmcn2 T A 2: 31,354,634 V701E probably damaging Het
Il21 A T 3: 37,232,453 I38N probably benign Het
Ip6k2 G T 9: 108,804,608 G246V probably damaging Het
Ipo13 T C 4: 117,900,988 Q726R probably damaging Het
Itsn1 A T 16: 91,906,770 N1521Y unknown Het
Kif2b A G 11: 91,576,305 V384A possibly damaging Het
L3mbtl1 G T 2: 162,966,068 R541L probably damaging Het
Lama3 T A 18: 12,481,063 C1296* probably null Het
Lars T C 18: 42,257,169 D11G probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Mmp27 C A 9: 7,581,249 F478L probably benign Het
Nav1 T A 1: 135,443,749 Q1746L unknown Het
Nedd9 T C 13: 41,318,508 Y165C probably damaging Het
Neurod1 T C 2: 79,454,376 Y221C probably damaging Het
Olfr1040 T C 2: 86,146,281 Y151C probably damaging Het
Olfr1154 T C 2: 87,903,563 T38A probably damaging Het
Olfr1228 G T 2: 89,249,201 F152L probably benign Het
Olfr450 A T 6: 42,817,611 I47F probably damaging Het
Orm3 A G 4: 63,356,296 N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,526 P241S probably damaging Het
Prdx6 A T 1: 161,251,049 I23N probably damaging Het
Prkd3 A T 17: 78,972,574 V334E probably benign Het
Prr12 A T 7: 45,034,722 D1631E probably damaging Het
Pum2 T G 12: 8,744,430 D773E probably damaging Het
Sidt2 A G 9: 45,945,350 C451R probably benign Het
Slc37a2 A G 9: 37,237,362 S275P probably benign Het
Slmap G T 14: 26,533,364 N54K probably benign Het
Susd4 A G 1: 182,854,032 D146G probably benign Het
Tekt3 G A 11: 63,081,343 R275H possibly damaging Het
Tkfc A G 19: 10,596,248 L242P probably damaging Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Triqk A T 4: 12,980,490 D78V probably damaging Het
Trmo T C 4: 46,382,322 D258G probably benign Het
Tsc2 A G 17: 24,607,515 V920A probably benign Het
Tspan17 C T 13: 54,796,178 Q257* probably null Het
Tube1 T A 10: 39,135,021 F45I probably damaging Het
Vmn1r4 A G 6: 56,956,837 T109A possibly damaging Het
Vmn2r14 A T 5: 109,220,036 Y363* probably null Het
Zfp324 G T 7: 12,971,528 G548V probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9116:Flg2 UTSW 3 93202284 missense unknown
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGCCAACATAGACATCCG -3'
(R):5'- GTTGATGTCTTGCCTGACCC -3'

Sequencing Primer
(F):5'- TGGCCAACATAGACATCCGCTATC -3'
(R):5'- CAGTGACTGGATCCAGAATGTCTC -3'
Posted On2021-11-19