Incidental Mutation 'R9039:Cyp4a14'
ID 687601
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115344461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 468 (V468E)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: V468E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V468E

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,213,849 (GRCm39) V692A possibly damaging Het
Aco2 C G 15: 81,756,620 (GRCm39) probably benign Het
Adcy10 T C 1: 165,345,914 (GRCm39) I321T probably damaging Het
Agbl2 C T 2: 90,645,730 (GRCm39) T821I probably benign Het
Alpk1 A G 3: 127,473,192 (GRCm39) L937P probably damaging Het
Atp5f1b A G 10: 127,919,767 (GRCm39) D45G probably benign Het
C8a C T 4: 104,679,200 (GRCm39) R530H probably benign Het
Cacna1s T C 1: 136,016,057 (GRCm39) S694P probably benign Het
Cdca7 T A 2: 72,312,856 (GRCm39) D162E probably benign Het
Cep78 G T 19: 15,936,907 (GRCm39) Q600K probably benign Het
Cert1 C T 13: 96,679,717 (GRCm39) P16S probably benign Het
Coq8b A C 7: 26,950,011 (GRCm39) R363S probably benign Het
Cpne3 A T 4: 19,540,770 (GRCm39) C202S probably damaging Het
Csmd3 G T 15: 47,483,308 (GRCm39) probably benign Het
Dchs1 A T 7: 105,405,215 (GRCm39) D2442E probably benign Het
Dip2a T C 10: 76,163,553 (GRCm39) Y49C probably benign Het
Dop1a A G 9: 86,382,870 (GRCm39) R268G probably damaging Het
Eid3 C T 10: 82,703,565 (GRCm39) S342L possibly damaging Het
Ezh2 A G 6: 47,528,671 (GRCm39) L296P possibly damaging Het
Fgfrl1 G C 5: 108,853,439 (GRCm39) probably null Het
Flg2 A G 3: 93,110,899 (GRCm39) R976G unknown Het
Fsip2 C A 2: 82,828,545 (GRCm39) Q6781K probably benign Het
Golga3 C T 5: 110,352,799 (GRCm39) H857Y probably benign Het
Hmcn2 T A 2: 31,244,646 (GRCm39) V701E probably damaging Het
Il21 A T 3: 37,286,602 (GRCm39) I38N probably benign Het
Ip6k2 G T 9: 108,681,807 (GRCm39) G246V probably damaging Het
Ipo13 T C 4: 117,758,185 (GRCm39) Q726R probably damaging Het
Itsn1 A T 16: 91,703,658 (GRCm39) N1521Y unknown Het
Kif2b A G 11: 91,467,131 (GRCm39) V384A possibly damaging Het
L3mbtl1 G T 2: 162,807,988 (GRCm39) R541L probably damaging Het
Lama3 T A 18: 12,614,120 (GRCm39) C1296* probably null Het
Lars1 T C 18: 42,390,234 (GRCm39) D11G probably damaging Het
Ly6c1 C A 15: 74,917,300 (GRCm39) G116V probably damaging Het
Mmp27 C A 9: 7,581,250 (GRCm39) F478L probably benign Het
Moxd1 T A 10: 24,155,251 (GRCm39) probably benign Het
Naaa T A 5: 92,420,300 (GRCm39) probably benign Het
Nav1 T A 1: 135,371,487 (GRCm39) Q1746L unknown Het
Nedd9 T C 13: 41,471,984 (GRCm39) Y165C probably damaging Het
Neurod1 T C 2: 79,284,720 (GRCm39) Y221C probably damaging Het
Or2q1 A T 6: 42,794,545 (GRCm39) I47F probably damaging Het
Or4c122 G T 2: 89,079,545 (GRCm39) F152L probably benign Het
Or5al6 T C 2: 85,976,625 (GRCm39) Y151C probably damaging Het
Or9m1 T C 2: 87,733,907 (GRCm39) T38A probably damaging Het
Orm3 A G 4: 63,274,533 (GRCm39) N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,525 (GRCm39) P241S probably damaging Het
Ppp1r9a A G 6: 5,134,657 (GRCm39) T949A probably benign Het
Prdx6 A T 1: 161,078,619 (GRCm39) I23N probably damaging Het
Prkd3 A T 17: 79,280,003 (GRCm39) V334E probably benign Het
Prr12 A T 7: 44,684,146 (GRCm39) D1631E probably damaging Het
Ptpn22 A G 3: 103,819,551 (GRCm39) probably benign Het
Pum2 T G 12: 8,794,430 (GRCm39) D773E probably damaging Het
Sidt2 A G 9: 45,856,648 (GRCm39) C451R probably benign Het
Slc37a2 A G 9: 37,148,658 (GRCm39) S275P probably benign Het
Slmap G T 14: 26,254,519 (GRCm39) N54K probably benign Het
Susd4 A G 1: 182,681,597 (GRCm39) D146G probably benign Het
Tekt3 G A 11: 62,972,169 (GRCm39) R275H possibly damaging Het
Tkfc A G 19: 10,573,612 (GRCm39) L242P probably damaging Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Triqk A T 4: 12,980,490 (GRCm39) D78V probably damaging Het
Trmo T C 4: 46,382,322 (GRCm39) D258G probably benign Het
Tsc2 A G 17: 24,826,489 (GRCm39) V920A probably benign Het
Tspan17 C T 13: 54,943,991 (GRCm39) Q257* probably null Het
Tube1 T A 10: 39,011,017 (GRCm39) F45I probably damaging Het
Vmn1r4 A G 6: 56,933,822 (GRCm39) T109A possibly damaging Het
Vmn2r14 A T 5: 109,367,902 (GRCm39) Y363* probably null Het
Zfp324 G T 7: 12,705,455 (GRCm39) G548V probably benign Het
Zpld2 C A 4: 133,922,858 (GRCm39) V492F probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGACAGGACACATTGCAGAG -3'
(R):5'- GCTGATACCATCATGGGGAAC -3'

Sequencing Primer
(F):5'- CCAGAGACAAAAGCAGGTATTG -3'
(R):5'- AACCTGGATGCCCCTCAG -3'
Posted On 2021-11-19