Incidental Mutation 'R9039:Golga3'
ID 687606
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110204933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 857 (H857Y)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: H897Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: H897Y

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: H857Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: H857Y

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,167,075 V692A possibly damaging Het
Adcy10 T C 1: 165,518,345 I321T probably damaging Het
Agbl2 C T 2: 90,815,386 T821I probably benign Het
Alpk1 A G 3: 127,679,543 L937P probably damaging Het
Atp5b A G 10: 128,083,898 D45G probably benign Het
C8a C T 4: 104,822,003 R530H probably benign Het
Cacna1s T C 1: 136,088,319 S694P probably benign Het
Cdca7 T A 2: 72,482,512 D162E probably benign Het
Cep78 G T 19: 15,959,543 Q600K probably benign Het
Col4a3bp C T 13: 96,543,209 P16S probably benign Het
Coq8b A C 7: 27,250,586 R363S probably benign Het
Cpne3 A T 4: 19,540,770 C202S probably damaging Het
Cyp4a14 A T 4: 115,487,264 V468E probably damaging Het
Dchs1 A T 7: 105,756,008 D2442E probably benign Het
Dip2a T C 10: 76,327,719 Y49C probably benign Het
Dopey1 A G 9: 86,500,817 R268G probably damaging Het
Eid3 C T 10: 82,867,731 S342L possibly damaging Het
Ezh2 A G 6: 47,551,737 L296P possibly damaging Het
Fgfrl1 G C 5: 108,705,573 probably null Het
Flg2 A G 3: 93,203,592 R976G unknown Het
Fsip2 C A 2: 82,998,201 Q6781K probably benign Het
Gm7534 C A 4: 134,195,547 V492F probably damaging Het
Hmcn2 T A 2: 31,354,634 V701E probably damaging Het
Il21 A T 3: 37,232,453 I38N probably benign Het
Ip6k2 G T 9: 108,804,608 G246V probably damaging Het
Ipo13 T C 4: 117,900,988 Q726R probably damaging Het
Itsn1 A T 16: 91,906,770 N1521Y unknown Het
Kif2b A G 11: 91,576,305 V384A possibly damaging Het
L3mbtl1 G T 2: 162,966,068 R541L probably damaging Het
Lama3 T A 18: 12,481,063 C1296* probably null Het
Lars T C 18: 42,257,169 D11G probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Mmp27 C A 9: 7,581,249 F478L probably benign Het
Nav1 T A 1: 135,443,749 Q1746L unknown Het
Nedd9 T C 13: 41,318,508 Y165C probably damaging Het
Neurod1 T C 2: 79,454,376 Y221C probably damaging Het
Olfr1040 T C 2: 86,146,281 Y151C probably damaging Het
Olfr1154 T C 2: 87,903,563 T38A probably damaging Het
Olfr1228 G T 2: 89,249,201 F152L probably benign Het
Olfr450 A T 6: 42,817,611 I47F probably damaging Het
Orm3 A G 4: 63,356,296 N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,526 P241S probably damaging Het
Prdx6 A T 1: 161,251,049 I23N probably damaging Het
Prkd3 A T 17: 78,972,574 V334E probably benign Het
Prr12 A T 7: 45,034,722 D1631E probably damaging Het
Pum2 T G 12: 8,744,430 D773E probably damaging Het
Sidt2 A G 9: 45,945,350 C451R probably benign Het
Slc37a2 A G 9: 37,237,362 S275P probably benign Het
Slmap G T 14: 26,533,364 N54K probably benign Het
Susd4 A G 1: 182,854,032 D146G probably benign Het
Tekt3 G A 11: 63,081,343 R275H possibly damaging Het
Tkfc A G 19: 10,596,248 L242P probably damaging Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Triqk A T 4: 12,980,490 D78V probably damaging Het
Trmo T C 4: 46,382,322 D258G probably benign Het
Tsc2 A G 17: 24,607,515 V920A probably benign Het
Tspan17 C T 13: 54,796,178 Q257* probably null Het
Tube1 T A 10: 39,135,021 F45I probably damaging Het
Vmn1r4 A G 6: 56,956,837 T109A possibly damaging Het
Vmn2r14 A T 5: 109,220,036 Y363* probably null Het
Zfp324 G T 7: 12,971,528 G548V probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAGGCAGCCTTATTCCTCGAG -3'
(R):5'- AAAAGTCTTTCTTGGTCAATGCTCC -3'

Sequencing Primer
(F):5'- GCAGCCTTATTCCTCGAGTAAGATAC -3'
(R):5'- ATTCCACCCGGTCCACAGG -3'
Posted On 2021-11-19