Incidental Mutation 'R9039:Ppp1r3a'
ID 687607
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14754525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 241 (P241S)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably damaging
Transcript: ENSMUST00000045096
AA Change: P241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: P241S

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,213,849 (GRCm39) V692A possibly damaging Het
Aco2 C G 15: 81,756,620 (GRCm39) probably benign Het
Adcy10 T C 1: 165,345,914 (GRCm39) I321T probably damaging Het
Agbl2 C T 2: 90,645,730 (GRCm39) T821I probably benign Het
Alpk1 A G 3: 127,473,192 (GRCm39) L937P probably damaging Het
Atp5f1b A G 10: 127,919,767 (GRCm39) D45G probably benign Het
C8a C T 4: 104,679,200 (GRCm39) R530H probably benign Het
Cacna1s T C 1: 136,016,057 (GRCm39) S694P probably benign Het
Cdca7 T A 2: 72,312,856 (GRCm39) D162E probably benign Het
Cep78 G T 19: 15,936,907 (GRCm39) Q600K probably benign Het
Cert1 C T 13: 96,679,717 (GRCm39) P16S probably benign Het
Coq8b A C 7: 26,950,011 (GRCm39) R363S probably benign Het
Cpne3 A T 4: 19,540,770 (GRCm39) C202S probably damaging Het
Csmd3 G T 15: 47,483,308 (GRCm39) probably benign Het
Cyp4a14 A T 4: 115,344,461 (GRCm39) V468E probably damaging Het
Dchs1 A T 7: 105,405,215 (GRCm39) D2442E probably benign Het
Dip2a T C 10: 76,163,553 (GRCm39) Y49C probably benign Het
Dop1a A G 9: 86,382,870 (GRCm39) R268G probably damaging Het
Eid3 C T 10: 82,703,565 (GRCm39) S342L possibly damaging Het
Ezh2 A G 6: 47,528,671 (GRCm39) L296P possibly damaging Het
Fgfrl1 G C 5: 108,853,439 (GRCm39) probably null Het
Flg2 A G 3: 93,110,899 (GRCm39) R976G unknown Het
Fsip2 C A 2: 82,828,545 (GRCm39) Q6781K probably benign Het
Golga3 C T 5: 110,352,799 (GRCm39) H857Y probably benign Het
Hmcn2 T A 2: 31,244,646 (GRCm39) V701E probably damaging Het
Il21 A T 3: 37,286,602 (GRCm39) I38N probably benign Het
Ip6k2 G T 9: 108,681,807 (GRCm39) G246V probably damaging Het
Ipo13 T C 4: 117,758,185 (GRCm39) Q726R probably damaging Het
Itsn1 A T 16: 91,703,658 (GRCm39) N1521Y unknown Het
Kif2b A G 11: 91,467,131 (GRCm39) V384A possibly damaging Het
L3mbtl1 G T 2: 162,807,988 (GRCm39) R541L probably damaging Het
Lama3 T A 18: 12,614,120 (GRCm39) C1296* probably null Het
Lars1 T C 18: 42,390,234 (GRCm39) D11G probably damaging Het
Ly6c1 C A 15: 74,917,300 (GRCm39) G116V probably damaging Het
Mmp27 C A 9: 7,581,250 (GRCm39) F478L probably benign Het
Moxd1 T A 10: 24,155,251 (GRCm39) probably benign Het
Naaa T A 5: 92,420,300 (GRCm39) probably benign Het
Nav1 T A 1: 135,371,487 (GRCm39) Q1746L unknown Het
Nedd9 T C 13: 41,471,984 (GRCm39) Y165C probably damaging Het
Neurod1 T C 2: 79,284,720 (GRCm39) Y221C probably damaging Het
Or2q1 A T 6: 42,794,545 (GRCm39) I47F probably damaging Het
Or4c122 G T 2: 89,079,545 (GRCm39) F152L probably benign Het
Or5al6 T C 2: 85,976,625 (GRCm39) Y151C probably damaging Het
Or9m1 T C 2: 87,733,907 (GRCm39) T38A probably damaging Het
Orm3 A G 4: 63,274,533 (GRCm39) N33D possibly damaging Het
Ppp1r9a A G 6: 5,134,657 (GRCm39) T949A probably benign Het
Prdx6 A T 1: 161,078,619 (GRCm39) I23N probably damaging Het
Prkd3 A T 17: 79,280,003 (GRCm39) V334E probably benign Het
Prr12 A T 7: 44,684,146 (GRCm39) D1631E probably damaging Het
Ptpn22 A G 3: 103,819,551 (GRCm39) probably benign Het
Pum2 T G 12: 8,794,430 (GRCm39) D773E probably damaging Het
Sidt2 A G 9: 45,856,648 (GRCm39) C451R probably benign Het
Slc37a2 A G 9: 37,148,658 (GRCm39) S275P probably benign Het
Slmap G T 14: 26,254,519 (GRCm39) N54K probably benign Het
Susd4 A G 1: 182,681,597 (GRCm39) D146G probably benign Het
Tekt3 G A 11: 62,972,169 (GRCm39) R275H possibly damaging Het
Tkfc A G 19: 10,573,612 (GRCm39) L242P probably damaging Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Triqk A T 4: 12,980,490 (GRCm39) D78V probably damaging Het
Trmo T C 4: 46,382,322 (GRCm39) D258G probably benign Het
Tsc2 A G 17: 24,826,489 (GRCm39) V920A probably benign Het
Tspan17 C T 13: 54,943,991 (GRCm39) Q257* probably null Het
Tube1 T A 10: 39,011,017 (GRCm39) F45I probably damaging Het
Vmn1r4 A G 6: 56,933,822 (GRCm39) T109A possibly damaging Het
Vmn2r14 A T 5: 109,367,902 (GRCm39) Y363* probably null Het
Zfp324 G T 7: 12,705,455 (GRCm39) G548V probably benign Het
Zpld2 C A 4: 133,922,858 (GRCm39) V492F probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGCCTAAGCAGTATTGACCTG -3'
(R):5'- CAGAATATGTTCCTAACTCGTGCG -3'

Sequencing Primer
(F):5'- GCAGTATTGACCTGCTACATGTGAC -3'
(R):5'- GACGGTGAGACTGACCAATTCTC -3'
Posted On 2021-11-19