Mutagenetix > Incidental Mutation

Incidental Mutation 'R9039:Dchs1'

687614

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9039 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105756008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2442 (D2442E)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033184

SMART Domains

Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
Pro-kuma_activ	32	176	4.53e-50	SMART
low complexity region	177	189	N/A	INTRINSIC
Pfam:Peptidase_S8	251	492	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000078482
AA Change: D2442E

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: D2442E

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140959

Predicted Effect

probably benign
Transcript: ENSMUST00000210066

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,167,075	V692A	possibly damaging	Het
Aco2	C	G	15: 81,872,419		probably benign	Het
Adcy10	T	C	1: 165,518,345	I321T	probably damaging	Het
Agbl2	C	T	2: 90,815,386	T821I	probably benign	Het
Alpk1	A	G	3: 127,679,543	L937P	probably damaging	Het
Atp5b	A	G	10: 128,083,898	D45G	probably benign	Het
C8a	C	T	4: 104,822,003	R530H	probably benign	Het
Cacna1s	T	C	1: 136,088,319	S694P	probably benign	Het
Cdca7	T	A	2: 72,482,512	D162E	probably benign	Het
Cep78	G	T	19: 15,959,543	Q600K	probably benign	Het
Col4a3bp	C	T	13: 96,543,209	P16S	probably benign	Het
Coq8b	A	C	7: 27,250,586	R363S	probably benign	Het
Cpne3	A	T	4: 19,540,770	C202S	probably damaging	Het
Csmd3	G	T	15: 47,619,912		probably benign	Het
Cyp4a14	A	T	4: 115,487,264	V468E	probably damaging	Het
Dip2a	T	C	10: 76,327,719	Y49C	probably benign	Het
Dopey1	A	G	9: 86,500,817	R268G	probably damaging	Het
Eid3	C	T	10: 82,867,731	S342L	possibly damaging	Het
Ezh2	A	G	6: 47,551,737	L296P	possibly damaging	Het
Fgfrl1	G	C	5: 108,705,573		probably null	Het
Flg2	A	G	3: 93,203,592	R976G	unknown	Het
Fsip2	C	A	2: 82,998,201	Q6781K	probably benign	Het
Gm7534	C	A	4: 134,195,547	V492F	probably damaging	Het
Golga3	C	T	5: 110,204,933	H857Y	probably benign	Het
Hmcn2	T	A	2: 31,354,634	V701E	probably damaging	Het
Il21	A	T	3: 37,232,453	I38N	probably benign	Het
Ip6k2	G	T	9: 108,804,608	G246V	probably damaging	Het
Ipo13	T	C	4: 117,900,988	Q726R	probably damaging	Het
Itsn1	A	T	16: 91,906,770	N1521Y	unknown	Het
Kif2b	A	G	11: 91,576,305	V384A	possibly damaging	Het
L3mbtl1	G	T	2: 162,966,068	R541L	probably damaging	Het
Lama3	T	A	18: 12,481,063	C1296*	probably null	Het
Lars	T	C	18: 42,257,169	D11G	probably damaging	Het
Ly6c1	C	A	15: 75,045,451	G116V	probably damaging	Het
Mmp27	C	A	9: 7,581,249	F478L	probably benign	Het
Moxd1	T	A	10: 24,279,353		probably benign	Het
Naaa	T	A	5: 92,272,441		probably benign	Het
Nav1	T	A	1: 135,443,749	Q1746L	unknown	Het
Nedd9	T	C	13: 41,318,508	Y165C	probably damaging	Het
Neurod1	T	C	2: 79,454,376	Y221C	probably damaging	Het
Olfr1040	T	C	2: 86,146,281	Y151C	probably damaging	Het
Olfr1154	T	C	2: 87,903,563	T38A	probably damaging	Het
Olfr1228	G	T	2: 89,249,201	F152L	probably benign	Het
Olfr450	A	T	6: 42,817,611	I47F	probably damaging	Het
Orm3	A	G	4: 63,356,296	N33D	possibly damaging	Het
Ppp1r3a	G	A	6: 14,754,526	P241S	probably damaging	Het
Ppp1r9a	A	G	6: 5,134,657	T949A	probably benign	Het
Prdx6	A	T	1: 161,251,049	I23N	probably damaging	Het
Prkd3	A	T	17: 78,972,574	V334E	probably benign	Het
Prr12	A	T	7: 45,034,722	D1631E	probably damaging	Het
Ptpn22	A	G	3: 103,912,235		probably benign	Het
Pum2	T	G	12: 8,744,430	D773E	probably damaging	Het
Sidt2	A	G	9: 45,945,350	C451R	probably benign	Het
Slc37a2	A	G	9: 37,237,362	S275P	probably benign	Het
Slmap	G	T	14: 26,533,364	N54K	probably benign	Het
Susd4	A	G	1: 182,854,032	D146G	probably benign	Het
Tekt3	G	A	11: 63,081,343	R275H	possibly damaging	Het
Tkfc	A	G	19: 10,596,248	L242P	probably damaging	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Triqk	A	T	4: 12,980,490	D78V	probably damaging	Het
Trmo	T	C	4: 46,382,322	D258G	probably benign	Het
Tsc2	A	G	17: 24,607,515	V920A	probably benign	Het
Tspan17	C	T	13: 54,796,178	Q257*	probably null	Het
Tube1	T	A	10: 39,135,021	F45I	probably damaging	Het
Vmn1r4	A	G	6: 56,956,837	T109A	possibly damaging	Het
Vmn2r14	A	T	5: 109,220,036	Y363*	probably null	Het
Zfp324	G	T	7: 12,971,528	G548V	probably benign	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTTCCATCAGCATCTGTGG -3'
(R):5'- ATACCTGAGGACACTGCGTG -3'

Sequencing Primer
(F):5'- ATCAGCATCTGTGGCCTCCAG -3'
(R):5'- AGCACATGAGCCGTTCTC -3'

Posted On

2021-11-19