Incidental Mutation 'R9039:Tm9sf2'
ID 687632
Institutional Source Beutler Lab
Gene Symbol Tm9sf2
Ensembl Gene ENSMUSG00000025544
Gene Name transmembrane 9 superfamily member 2
Synonyms D14Ertd64e, P76, 1500001N15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock # R9039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 122107038-122159604 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122126164 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 99 (L99I)
Ref Sequence ENSEMBL: ENSMUSP00000026624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026624] [ENSMUST00000170007] [ENSMUST00000171318]
AlphaFold P58021
Predicted Effect probably benign
Transcript: ENSMUST00000026624
AA Change: L99I

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026624
Gene: ENSMUSG00000025544
AA Change: L99I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 74 619 4.5e-209 PFAM
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166043
Predicted Effect probably benign
Transcript: ENSMUST00000170007
SMART Domains Protein: ENSMUSP00000128894
Gene: ENSMUSG00000025544

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171318
AA Change: L99I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131227
Gene: ENSMUSG00000025544
AA Change: L99I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 73 112 5.9e-9 PFAM
Pfam:EMP70 109 455 1e-172 PFAM
transmembrane domain 465 487 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,167,075 V692A possibly damaging Het
Adcy10 T C 1: 165,518,345 I321T probably damaging Het
Agbl2 C T 2: 90,815,386 T821I probably benign Het
Alpk1 A G 3: 127,679,543 L937P probably damaging Het
Atp5b A G 10: 128,083,898 D45G probably benign Het
C8a C T 4: 104,822,003 R530H probably benign Het
Cacna1s T C 1: 136,088,319 S694P probably benign Het
Cdca7 T A 2: 72,482,512 D162E probably benign Het
Cep78 G T 19: 15,959,543 Q600K probably benign Het
Col4a3bp C T 13: 96,543,209 P16S probably benign Het
Coq8b A C 7: 27,250,586 R363S probably benign Het
Cpne3 A T 4: 19,540,770 C202S probably damaging Het
Cyp4a14 A T 4: 115,487,264 V468E probably damaging Het
Dchs1 A T 7: 105,756,008 D2442E probably benign Het
Dip2a T C 10: 76,327,719 Y49C probably benign Het
Dopey1 A G 9: 86,500,817 R268G probably damaging Het
Eid3 C T 10: 82,867,731 S342L possibly damaging Het
Ezh2 A G 6: 47,551,737 L296P possibly damaging Het
Fgfrl1 G C 5: 108,705,573 probably null Het
Flg2 A G 3: 93,203,592 R976G unknown Het
Fsip2 C A 2: 82,998,201 Q6781K probably benign Het
Gm7534 C A 4: 134,195,547 V492F probably damaging Het
Golga3 C T 5: 110,204,933 H857Y probably benign Het
Hmcn2 T A 2: 31,354,634 V701E probably damaging Het
Il21 A T 3: 37,232,453 I38N probably benign Het
Ip6k2 G T 9: 108,804,608 G246V probably damaging Het
Ipo13 T C 4: 117,900,988 Q726R probably damaging Het
Itsn1 A T 16: 91,906,770 N1521Y unknown Het
Kif2b A G 11: 91,576,305 V384A possibly damaging Het
L3mbtl1 G T 2: 162,966,068 R541L probably damaging Het
Lama3 T A 18: 12,481,063 C1296* probably null Het
Lars T C 18: 42,257,169 D11G probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Mmp27 C A 9: 7,581,249 F478L probably benign Het
Nav1 T A 1: 135,443,749 Q1746L unknown Het
Nedd9 T C 13: 41,318,508 Y165C probably damaging Het
Neurod1 T C 2: 79,454,376 Y221C probably damaging Het
Olfr1040 T C 2: 86,146,281 Y151C probably damaging Het
Olfr1154 T C 2: 87,903,563 T38A probably damaging Het
Olfr1228 G T 2: 89,249,201 F152L probably benign Het
Olfr450 A T 6: 42,817,611 I47F probably damaging Het
Orm3 A G 4: 63,356,296 N33D possibly damaging Het
Ppp1r3a G A 6: 14,754,526 P241S probably damaging Het
Prdx6 A T 1: 161,251,049 I23N probably damaging Het
Prkd3 A T 17: 78,972,574 V334E probably benign Het
Prr12 A T 7: 45,034,722 D1631E probably damaging Het
Pum2 T G 12: 8,744,430 D773E probably damaging Het
Sidt2 A G 9: 45,945,350 C451R probably benign Het
Slc37a2 A G 9: 37,237,362 S275P probably benign Het
Slmap G T 14: 26,533,364 N54K probably benign Het
Susd4 A G 1: 182,854,032 D146G probably benign Het
Tekt3 G A 11: 63,081,343 R275H possibly damaging Het
Tkfc A G 19: 10,596,248 L242P probably damaging Het
Triqk A T 4: 12,980,490 D78V probably damaging Het
Trmo T C 4: 46,382,322 D258G probably benign Het
Tsc2 A G 17: 24,607,515 V920A probably benign Het
Tspan17 C T 13: 54,796,178 Q257* probably null Het
Tube1 T A 10: 39,135,021 F45I probably damaging Het
Vmn1r4 A G 6: 56,956,837 T109A possibly damaging Het
Vmn2r14 A T 5: 109,220,036 Y363* probably null Het
Zfp324 G T 7: 12,971,528 G548V probably benign Het
Other mutations in Tm9sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Tm9sf2 APN 14 122143460 missense probably damaging 1.00
IGL01995:Tm9sf2 APN 14 122143471 missense probably benign 0.25
IGL02173:Tm9sf2 APN 14 122143423 missense probably benign 0.13
IGL02249:Tm9sf2 APN 14 122123750 missense probably damaging 1.00
IGL02328:Tm9sf2 APN 14 122143430 missense possibly damaging 0.79
IGL03231:Tm9sf2 APN 14 122141252 missense possibly damaging 0.95
R0367:Tm9sf2 UTSW 14 122155368 missense probably benign 0.06
R1959:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
R2251:Tm9sf2 UTSW 14 122139731 missense probably benign
R2504:Tm9sf2 UTSW 14 122158684 missense probably benign 0.01
R4791:Tm9sf2 UTSW 14 122139650 missense probably benign 0.00
R4795:Tm9sf2 UTSW 14 122149840 splice site probably null
R4851:Tm9sf2 UTSW 14 122141204 missense probably benign 0.00
R5063:Tm9sf2 UTSW 14 122145146 missense probably damaging 1.00
R5117:Tm9sf2 UTSW 14 122143501 missense probably benign 0.30
R5443:Tm9sf2 UTSW 14 122126195 missense probably damaging 0.97
R5677:Tm9sf2 UTSW 14 122151962 critical splice acceptor site probably null
R5966:Tm9sf2 UTSW 14 122137509 intron probably benign
R6465:Tm9sf2 UTSW 14 122141207 missense probably benign 0.16
R6873:Tm9sf2 UTSW 14 122145113 missense probably damaging 1.00
R7403:Tm9sf2 UTSW 14 122141228 missense probably benign 0.33
R7531:Tm9sf2 UTSW 14 122142412 missense possibly damaging 0.49
R8176:Tm9sf2 UTSW 14 122137501 missense probably benign 0.01
R8447:Tm9sf2 UTSW 14 122139768 missense probably damaging 1.00
R8773:Tm9sf2 UTSW 14 122143471 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCCTGAGACTTAAACGTAAGC -3'
(R):5'- AAGGGTCTTTCTAAACCAAGGC -3'

Sequencing Primer
(F):5'- GCACATTCCTCATTTAAAGAGCTC -3'
(R):5'- GGTCCAGGATTTGATTCCCAGAAC -3'
Posted On 2021-11-19