Incidental Mutation 'R9040:Rhbdf1'
ID 687679
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R9040 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32213063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 438 (T438A)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000144902] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably benign
Transcript: ENSMUST00000020524
AA Change: T438A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: T438A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143988
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144902
SMART Domains Protein: ENSMUSP00000122533
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A C 8: 43,650,326 probably benign Het
Agap1 T C 1: 89,743,744 V391A probably damaging Het
Apba2 C T 7: 64,743,324 A531V possibly damaging Het
Apcdd1 T A 18: 62,937,343 V227E probably damaging Het
AW822073 A G 10: 58,223,786 I382T unknown Het
Bbs7 A G 3: 36,575,838 V564A probably benign Het
Ccdc154 T A 17: 25,163,819 M141K possibly damaging Het
Cdk9 C A 2: 32,707,987 Q352H probably benign Het
Chsy3 T C 18: 59,409,688 Y633H probably damaging Het
Cpz T A 5: 35,515,491 Y195F possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dhodh A T 8: 109,602,149 probably benign Het
Dlec1 G A 9: 119,121,917 S517N probably benign Het
Dock7 A T 4: 99,001,127 L175* probably null Het
Ect2l A T 10: 18,201,350 S2T possibly damaging Het
Epn3 G A 11: 94,491,923 S445F possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm609 C A 16: 45,444,146 K16N possibly damaging Het
Gm7298 T C 6: 121,787,479 F1439S probably benign Het
Hormad1 A T 3: 95,580,159 E289D possibly damaging Het
Idua T C 5: 108,681,063 L391P probably damaging Het
Kank2 G T 9: 21,794,819 A301E probably damaging Het
Kcnk10 C T 12: 98,434,839 E526K probably benign Het
Kif16b T C 2: 142,849,878 I229V probably benign Het
Krt25 T C 11: 99,316,553 Y400C probably benign Het
Krt26 C T 11: 99,331,267 G405S probably benign Het
Krt42 G A 11: 100,267,033 R202W probably damaging Het
Lbr A G 1: 181,817,345 V547A probably damaging Het
Lrrc8b T C 5: 105,480,295 L169P probably benign Het
Midn T A 10: 80,154,084 V262D probably damaging Het
Mroh9 T A 1: 163,062,500 I223F probably benign Het
Mtor C A 4: 148,463,748 A490E probably benign Het
Muc16 G A 9: 18,644,786 Q3404* probably null Het
Myo5a A T 9: 75,174,059 E975D probably benign Het
Ncoa7 T C 10: 30,654,393 Y764C probably benign Het
Nedd4l T C 18: 65,209,663 L769P probably damaging Het
Olfr741 G T 14: 50,485,538 G27W probably benign Het
Pank4 C G 4: 154,980,102 T706R probably benign Het
Plxnc1 G T 10: 94,943,517 C354* probably null Het
Prkca A G 11: 108,014,360 I184T possibly damaging Het
Prune2 T C 19: 17,120,627 V1165A probably damaging Het
Psmc6 T A 14: 45,343,654 D302E probably benign Het
Rab11fip5 A G 6: 85,347,933 L464P probably damaging Het
Reg1 A T 6: 78,426,285 probably benign Het
Ryr2 T C 13: 11,594,786 R4385G probably damaging Het
Ryr3 A G 2: 112,954,386 Y237H probably damaging Het
Scai G T 2: 39,075,152 T560K probably benign Het
Scn1a A G 2: 66,317,901 L80P probably damaging Het
Sez6 T C 11: 77,973,936 L574P probably benign Het
Slc41a1 T G 1: 131,840,885 S194A probably damaging Het
Slc6a7 T C 18: 61,001,288 probably benign Het
Slit3 A G 11: 35,703,309 H1442R probably damaging Het
Sra1 A T 18: 36,675,737 L281Q probably damaging Het
Steap2 A T 5: 5,682,722 W101R probably benign Het
Tfap2b C T 1: 19,234,090 R375W probably damaging Het
Tfr2 A T 5: 137,574,705 T233S probably benign Het
Traf3ip1 T A 1: 91,501,370 H286Q probably damaging Het
Ubash3a A G 17: 31,238,986 probably benign Het
Vmn2r85 A G 10: 130,418,442 I791T probably damaging Het
Zkscan4 T C 13: 21,484,059 C256R probably benign Het
Zscan4-ps3 A T 7: 11,612,711 N225Y probably benign Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
R8490:Rhbdf1 UTSW 11 32210162 missense probably damaging 0.98
R8939:Rhbdf1 UTSW 11 32210093 missense probably benign 0.00
R9257:Rhbdf1 UTSW 11 32210754 missense probably benign 0.00
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense not run
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCCAATCCAGAAGTTCTC -3'
(R):5'- CATGGATGATCACAGGTAGGCG -3'

Sequencing Primer
(F):5'- AGAAGTTCTCCTGCTGGACG -3'
(R):5'- TGGGACAGAGGCTGAGCTG -3'
Posted On 2021-11-19