Incidental Mutation 'R9040:Apcdd1'
ID 687696
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R9040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62937343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 227 (V227E)
Ref Sequence ENSEMBL: ENSMUSP00000094302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably damaging
Transcript: ENSMUST00000096554
AA Change: V227E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: V227E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163716
AA Change: V227E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: V227E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T C 1: 89,743,744 V391A probably damaging Het
Apba2 C T 7: 64,743,324 A531V possibly damaging Het
AW822073 A G 10: 58,223,786 I382T unknown Het
Bbs7 A G 3: 36,575,838 V564A probably benign Het
Ccdc154 T A 17: 25,163,819 M141K possibly damaging Het
Cdk9 C A 2: 32,707,987 Q352H probably benign Het
Chsy3 T C 18: 59,409,688 Y633H probably damaging Het
Cpz T A 5: 35,515,491 Y195F possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dlec1 G A 9: 119,121,917 S517N probably benign Het
Dock7 A T 4: 99,001,127 L175* probably null Het
Ect2l A T 10: 18,201,350 S2T possibly damaging Het
Epn3 G A 11: 94,491,923 S445F possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm609 C A 16: 45,444,146 K16N possibly damaging Het
Gm7298 T C 6: 121,787,479 F1439S probably benign Het
Hormad1 A T 3: 95,580,159 E289D possibly damaging Het
Idua T C 5: 108,681,063 L391P probably damaging Het
Kank2 G T 9: 21,794,819 A301E probably damaging Het
Kcnk10 C T 12: 98,434,839 E526K probably benign Het
Kif16b T C 2: 142,849,878 I229V probably benign Het
Krt25 T C 11: 99,316,553 Y400C probably benign Het
Krt26 C T 11: 99,331,267 G405S probably benign Het
Krt42 G A 11: 100,267,033 R202W probably damaging Het
Lbr A G 1: 181,817,345 V547A probably damaging Het
Lrrc8b T C 5: 105,480,295 L169P probably benign Het
Midn T A 10: 80,154,084 V262D probably damaging Het
Mroh9 T A 1: 163,062,500 I223F probably benign Het
Mtor C A 4: 148,463,748 A490E probably benign Het
Muc16 G A 9: 18,644,786 Q3404* probably null Het
Myo5a A T 9: 75,174,059 E975D probably benign Het
Ncoa7 T C 10: 30,654,393 Y764C probably benign Het
Nedd4l T C 18: 65,209,663 L769P probably damaging Het
Olfr741 G T 14: 50,485,538 G27W probably benign Het
Pank4 C G 4: 154,980,102 T706R probably benign Het
Plxnc1 G T 10: 94,943,517 C354* probably null Het
Prkca A G 11: 108,014,360 I184T possibly damaging Het
Prune2 T C 19: 17,120,627 V1165A probably damaging Het
Psmc6 T A 14: 45,343,654 D302E probably benign Het
Rab11fip5 A G 6: 85,347,933 L464P probably damaging Het
Reg1 A T 6: 78,426,285 probably benign Het
Rhbdf1 T C 11: 32,213,063 T438A probably benign Het
Ryr2 T C 13: 11,594,786 R4385G probably damaging Het
Ryr3 A G 2: 112,954,386 Y237H probably damaging Het
Scai G T 2: 39,075,152 T560K probably benign Het
Scn1a A G 2: 66,317,901 L80P probably damaging Het
Sez6 T C 11: 77,973,936 L574P probably benign Het
Slc41a1 T G 1: 131,840,885 S194A probably damaging Het
Slit3 A G 11: 35,703,309 H1442R probably damaging Het
Sra1 A T 18: 36,675,737 L281Q probably damaging Het
Steap2 A T 5: 5,682,722 W101R probably benign Het
Tfap2b C T 1: 19,234,090 R375W probably damaging Het
Tfr2 A T 5: 137,574,705 T233S probably benign Het
Traf3ip1 T A 1: 91,501,370 H286Q probably damaging Het
Vmn2r85 A G 10: 130,418,442 I791T probably damaging Het
Zkscan4 T C 13: 21,484,059 C256R probably benign Het
Zscan4-ps3 A T 7: 11,612,711 N225Y probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGTGAACCGAACTTGCC -3'
(R):5'- GAGGTAGAACCCTACATTCCTCAGG -3'

Sequencing Primer
(F):5'- CGAACTTGCCCAGGCTTC -3'
(R):5'- AGGATCTCTCTGACATGCCCAG -3'
Posted On 2021-11-19