Incidental Mutation 'R9041:Gm4737'
ID 687750
Institutional Source Beutler Lab
Gene Symbol Gm4737
Ensembl Gene ENSMUSG00000048087
Gene Name predicted gene 4737
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock # R9041 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 46152985-46155077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46154105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 303 (D303A)
Ref Sequence ENSEMBL: ENSMUSP00000127198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000059524
AA Change: D303A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127198
Gene: ENSMUSG00000048087
AA Change: D303A

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,192 I168T probably benign Het
Adcy8 A T 15: 64,737,438 I874N probably benign Het
Angptl1 G T 1: 156,858,429 D362Y probably damaging Het
Arc A G 15: 74,672,047 V109A probably damaging Het
Asphd2 T A 5: 112,391,902 T22S probably benign Het
Caprin2 A T 6: 148,869,532 N321K probably benign Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Cd163l1 T C 7: 140,228,590 C805R probably damaging Het
Cd38 G A 5: 43,901,557 probably null Het
Cd3g A G 9: 44,973,520 V142A possibly damaging Het
Chrna6 A T 8: 27,406,895 I318N probably damaging Het
Cmah T C 13: 24,457,021 probably null Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cplx4 T C 18: 65,970,026 M8V probably damaging Het
Dnajc19 T C 3: 34,080,133 K27R probably damaging Het
E2f3 C A 13: 29,909,956 D441Y probably damaging Het
Erap1 A G 13: 74,674,699 K777R probably benign Het
Fastkd1 C T 2: 69,702,371 V551I probably benign Het
Fgd5 A G 6: 91,987,446 E220G probably benign Het
Gal3st2 T C 1: 93,872,484 V19A possibly damaging Het
Ghr T C 15: 3,328,048 E246G probably benign Het
Gm10228 A T 16: 89,041,225 Y64N unknown Het
Gm9833 T C 3: 10,092,293 *499Q probably null Het
Gsdmc4 T C 15: 63,902,737 N65S probably benign Het
Heatr5b C A 17: 78,796,432 A1105S probably benign Het
Hipk2 A T 6: 38,747,974 L376* probably null Het
Il6st A G 13: 112,475,097 T18A probably benign Het
Kif3b T C 2: 153,317,548 I423T probably benign Het
Klf17 T C 4: 117,760,359 Y267C probably damaging Het
Kntc1 A G 5: 123,789,030 T1183A probably benign Het
Lrrc71 A G 3: 87,743,353 S201P probably damaging Het
Mrgprb5 A T 7: 48,168,761 D75E probably damaging Het
Myf6 A G 10: 107,493,364 V240A probably benign Het
Ncoa6 T C 2: 155,415,530 M698V possibly damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nynrin T C 14: 55,871,296 S1287P possibly damaging Het
Olfr509 A G 7: 108,646,382 S65P probably damaging Het
Otud4 T A 8: 79,673,812 S1052T probably damaging Het
Pcsk5 A T 19: 17,560,768 C898* probably null Het
Pdcd1 T C 1: 94,041,366 T76A probably benign Het
Plin2 T A 4: 86,660,267 M198L probably benign Het
Prmt7 T A 8: 106,236,828 V180D possibly damaging Het
R3hdm2 T C 10: 127,484,536 Y549H probably damaging Het
Rad54l2 A G 9: 106,722,819 S80P possibly damaging Het
Ryr3 T A 2: 112,957,201 E235D probably damaging Het
Serpina9 A T 12: 104,001,478 S219R Het
Sesn2 G A 4: 132,497,961 T298I probably benign Het
Sf3b2 A T 19: 5,274,844 V838E possibly damaging Het
Sfpq C A 4: 127,021,503 H29Q unknown Het
Smchd1 A G 17: 71,394,715 probably null Het
Sprr1b A G 3: 92,437,170 V133A probably benign Het
Srgap3 T C 6: 112,777,093 Y243C probably damaging Het
Thop1 C T 10: 81,081,394 A577V possibly damaging Het
Tmprss3 T A 17: 31,191,040 D200V probably benign Het
Treh A T 9: 44,685,380 K512M probably damaging Het
Trip11 A G 12: 101,878,868 V1537A probably benign Het
Trp63 A G 16: 25,763,333 T44A probably benign Het
Vmn1r225 T A 17: 20,502,315 M6K possibly damaging Het
Vmn2r90 A C 17: 17,734,024 M817L probably benign Het
Zfp68 A T 5: 138,606,437 Y541* probably null Het
Other mutations in Gm4737
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Gm4737 APN 16 46154078 missense probably benign
IGL03347:Gm4737 APN 16 46154489 missense probably benign 0.01
R0326:Gm4737 UTSW 16 46153883 missense probably benign 0.03
R0552:Gm4737 UTSW 16 46154592 missense probably benign
R0610:Gm4737 UTSW 16 46153901 missense probably damaging 1.00
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1473:Gm4737 UTSW 16 46154819 missense probably damaging 1.00
R2997:Gm4737 UTSW 16 46153925 missense possibly damaging 0.83
R4546:Gm4737 UTSW 16 46153967 missense possibly damaging 0.81
R4818:Gm4737 UTSW 16 46154192 missense probably damaging 1.00
R6544:Gm4737 UTSW 16 46154784 missense probably benign
R7358:Gm4737 UTSW 16 46153838 missense probably damaging 1.00
R7689:Gm4737 UTSW 16 46154607 missense probably benign 0.12
R8260:Gm4737 UTSW 16 46154423 missense probably damaging 1.00
R9048:Gm4737 UTSW 16 46154195 missense probably damaging 1.00
Z1176:Gm4737 UTSW 16 46154229 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCAATCTGTGCCATCACCTG -3'
(R):5'- GAGTCATCATCACCGAGATCG -3'

Sequencing Primer
(F):5'- CCATCACCTGGTTTGTGAAGG -3'
(R):5'- GATCGACCCCATCAATGCACTG -3'
Posted On 2021-11-19