Incidental Mutation 'R9042:Gm597'
ID 687761
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9042 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28776956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 665 (Q665R)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000059937
AA Change: Q665R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: Q665R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,287,351 I3275T probably benign Het
Adamts12 A G 15: 11,152,048 K208R probably benign Het
Amh T C 10: 80,806,609 M242T possibly damaging Het
Anpep T C 7: 79,838,762 Y440C probably damaging Het
Atf7ip G T 6: 136,561,265 E499* probably null Het
Clasp2 A G 9: 113,905,997 I967V probably benign Het
Cpa6 T C 1: 10,337,290 T341A probably benign Het
Cyp26b1 T A 6: 84,576,608 Y263F probably benign Het
Ecm2 C A 13: 49,528,963 Y489* probably null Het
Gpr22 C A 12: 31,709,854 V90L probably benign Het
Grip1 G A 10: 120,000,533 V516M probably benign Het
Ipo5 C T 14: 120,923,135 S188L probably benign Het
Kcnh6 T A 11: 106,017,638 I360N possibly damaging Het
Lrp1b C A 2: 41,502,017 D512Y Het
Lrpprc C T 17: 84,752,308 probably null Het
Lta4h A G 10: 93,482,988 K547R probably benign Het
Nacad G C 11: 6,598,948 P1340R possibly damaging Het
Ncapd2 T C 6: 125,179,338 K495E probably benign Het
Ndufaf7 A T 17: 78,938,539 probably null Het
Nsrp1 A G 11: 77,050,651 V77A probably benign Het
Olfr1087 T C 2: 86,690,795 Y60C probably damaging Het
Olfr161 A T 16: 3,593,268 S291C probably damaging Het
P2ry12 A G 3: 59,218,035 V73A probably damaging Het
Pafah1b1 G A 11: 74,683,667 T231I probably benign Het
Parp11 C A 6: 127,471,652 Y77* probably null Het
Phc3 T A 3: 30,929,767 T712S unknown Het
Pkm T A 9: 59,671,937 I335N probably damaging Het
Pmpca A G 2: 26,393,569 T417A probably benign Het
Pot1b C T 17: 55,699,991 probably null Het
Prrc1 T A 18: 57,374,692 probably null Het
Psg18 A T 7: 18,349,122 N369K probably benign Het
Pum3 T A 19: 27,422,391 Y214F probably damaging Het
Reln G A 5: 22,048,038 T637M probably damaging Het
Rpe65 A T 3: 159,615,655 Y368F probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Serpinb3c T A 1: 107,272,001 L263F probably damaging Het
Slc25a23 C T 17: 57,045,553 V444I probably damaging Het
Slc40a1 C T 1: 45,909,461 G553D probably benign Het
Taf7 C A 18: 37,643,170 D115Y probably damaging Het
Tanc1 G C 2: 59,843,422 A1624P probably benign Het
Tmed4 T C 11: 6,274,405 D85G probably benign Het
Tmed6 A G 8: 107,063,753 V138A probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Ttc38 A G 15: 85,836,109 T91A probably benign Het
Ube4b C G 4: 149,360,376 A476P probably benign Het
Vmn2r53 A G 7: 12,581,508 C795R probably benign Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATGTTGACTGTGCTCCTCAG -3'
(R):5'- GGCCAAGGAAACCTACACATTG -3'

Sequencing Primer
(F):5'- AGGACTCCTGTGGCTACTG -3'
(R):5'- GGAAACCTACACATTGAAAGTAAAAG -3'
Posted On 2021-11-19