Incidental Mutation 'R9042:Rpe65'
ID 687770
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms A930029L06Rik, Mord1, rd12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9042 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 159599175-159625321 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 159615655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 368 (Y368F)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: Y368F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: Y368F

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: Y368F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: Y368F

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,287,351 I3275T probably benign Het
Adamts12 A G 15: 11,152,048 K208R probably benign Het
Amh T C 10: 80,806,609 M242T possibly damaging Het
Anpep T C 7: 79,838,762 Y440C probably damaging Het
Atf7ip G T 6: 136,561,265 E499* probably null Het
Clasp2 A G 9: 113,905,997 I967V probably benign Het
Cpa6 T C 1: 10,337,290 T341A probably benign Het
Cyp26b1 T A 6: 84,576,608 Y263F probably benign Het
Ecm2 C A 13: 49,528,963 Y489* probably null Het
Gm597 T C 1: 28,776,956 Q665R possibly damaging Het
Gpr22 C A 12: 31,709,854 V90L probably benign Het
Grip1 G A 10: 120,000,533 V516M probably benign Het
Ipo5 C T 14: 120,923,135 S188L probably benign Het
Kcnh6 T A 11: 106,017,638 I360N possibly damaging Het
Lrp1b C A 2: 41,502,017 D512Y Het
Lrpprc C T 17: 84,752,308 probably null Het
Lta4h A G 10: 93,482,988 K547R probably benign Het
Nacad G C 11: 6,598,948 P1340R possibly damaging Het
Ncapd2 T C 6: 125,179,338 K495E probably benign Het
Ndufaf7 A T 17: 78,938,539 probably null Het
Nsrp1 A G 11: 77,050,651 V77A probably benign Het
Olfr1087 T C 2: 86,690,795 Y60C probably damaging Het
Olfr161 A T 16: 3,593,268 S291C probably damaging Het
P2ry12 A G 3: 59,218,035 V73A probably damaging Het
Pafah1b1 G A 11: 74,683,667 T231I probably benign Het
Parp11 C A 6: 127,471,652 Y77* probably null Het
Phc3 T A 3: 30,929,767 T712S unknown Het
Pkm T A 9: 59,671,937 I335N probably damaging Het
Pmpca A G 2: 26,393,569 T417A probably benign Het
Pot1b C T 17: 55,699,991 probably null Het
Prrc1 T A 18: 57,374,692 probably null Het
Psg18 A T 7: 18,349,122 N369K probably benign Het
Pum3 T A 19: 27,422,391 Y214F probably damaging Het
Reln G A 5: 22,048,038 T637M probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Serpinb3c T A 1: 107,272,001 L263F probably damaging Het
Slc25a23 C T 17: 57,045,553 V444I probably damaging Het
Slc40a1 C T 1: 45,909,461 G553D probably benign Het
Taf7 C A 18: 37,643,170 D115Y probably damaging Het
Tanc1 G C 2: 59,843,422 A1624P probably benign Het
Tmed4 T C 11: 6,274,405 D85G probably benign Het
Tmed6 A G 8: 107,063,753 V138A probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Ttc38 A G 15: 85,836,109 T91A probably benign Het
Ube4b C G 4: 149,360,376 A476P probably benign Het
Vmn2r53 A G 7: 12,581,508 C795R probably benign Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159604393 missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
R8558:Rpe65 UTSW 3 159614792 missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159622681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGACCTAAGGAACAATCAC -3'
(R):5'- ATGGGAATCACTGGGTCTGTAG -3'

Sequencing Primer
(F):5'- AGTTCAAGGTCAGCCTATGC -3'
(R):5'- GTGGAAGTCACCCTTTCTAAATCAC -3'
Posted On 2021-11-19