Incidental Mutation 'R9042:Vmn2r53'
ID 687778
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R9042 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12581508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 795 (C795R)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: C795R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: C795R

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,287,351 I3275T probably benign Het
Adamts12 A G 15: 11,152,048 K208R probably benign Het
Amh T C 10: 80,806,609 M242T possibly damaging Het
Anpep T C 7: 79,838,762 Y440C probably damaging Het
Atf7ip G T 6: 136,561,265 E499* probably null Het
Clasp2 A G 9: 113,905,997 I967V probably benign Het
Cpa6 T C 1: 10,337,290 T341A probably benign Het
Cyp26b1 T A 6: 84,576,608 Y263F probably benign Het
Ecm2 C A 13: 49,528,963 Y489* probably null Het
Gm597 T C 1: 28,776,956 Q665R possibly damaging Het
Gpr22 C A 12: 31,709,854 V90L probably benign Het
Grip1 G A 10: 120,000,533 V516M probably benign Het
Ipo5 C T 14: 120,923,135 S188L probably benign Het
Kcnh6 T A 11: 106,017,638 I360N possibly damaging Het
Lrp1b C A 2: 41,502,017 D512Y Het
Lrpprc C T 17: 84,752,308 probably null Het
Lta4h A G 10: 93,482,988 K547R probably benign Het
Nacad G C 11: 6,598,948 P1340R possibly damaging Het
Ncapd2 T C 6: 125,179,338 K495E probably benign Het
Ndufaf7 A T 17: 78,938,539 probably null Het
Nsrp1 A G 11: 77,050,651 V77A probably benign Het
Olfr1087 T C 2: 86,690,795 Y60C probably damaging Het
Olfr161 A T 16: 3,593,268 S291C probably damaging Het
P2ry12 A G 3: 59,218,035 V73A probably damaging Het
Pafah1b1 G A 11: 74,683,667 T231I probably benign Het
Parp11 C A 6: 127,471,652 Y77* probably null Het
Phc3 T A 3: 30,929,767 T712S unknown Het
Pkm T A 9: 59,671,937 I335N probably damaging Het
Pmpca A G 2: 26,393,569 T417A probably benign Het
Pot1b C T 17: 55,699,991 probably null Het
Prrc1 T A 18: 57,374,692 probably null Het
Psg18 A T 7: 18,349,122 N369K probably benign Het
Pum3 T A 19: 27,422,391 Y214F probably damaging Het
Reln G A 5: 22,048,038 T637M probably damaging Het
Rpe65 A T 3: 159,615,655 Y368F probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Serpinb3c T A 1: 107,272,001 L263F probably damaging Het
Slc25a23 C T 17: 57,045,553 V444I probably damaging Het
Slc40a1 C T 1: 45,909,461 G553D probably benign Het
Taf7 C A 18: 37,643,170 D115Y probably damaging Het
Tanc1 G C 2: 59,843,422 A1624P probably benign Het
Tmed4 T C 11: 6,274,405 D85G probably benign Het
Tmed6 A G 8: 107,063,753 V138A probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Ttc38 A G 15: 85,836,109 T91A probably benign Het
Ube4b C G 4: 149,360,376 A476P probably benign Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGCGCACTTTGGCATTG -3'
(R):5'- GTGGCTGTAGAGATCTTTTCCATCC -3'

Sequencing Primer
(F):5'- TTGACATGCTCACTGGCAAG -3'
(R):5'- GTAGAGATCTTTTCCATCCTGGCC -3'
Posted On 2021-11-19