Incidental Mutation 'R9042:Psg18'
ID 687779
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9042 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18349122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 369 (N369K)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: N369K

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: N369K

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098783
AA Change: N248K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: N248K

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,287,351 I3275T probably benign Het
Adamts12 A G 15: 11,152,048 K208R probably benign Het
Amh T C 10: 80,806,609 M242T possibly damaging Het
Anpep T C 7: 79,838,762 Y440C probably damaging Het
Atf7ip G T 6: 136,561,265 E499* probably null Het
Clasp2 A G 9: 113,905,997 I967V probably benign Het
Cpa6 T C 1: 10,337,290 T341A probably benign Het
Cyp26b1 T A 6: 84,576,608 Y263F probably benign Het
Ecm2 C A 13: 49,528,963 Y489* probably null Het
Gm597 T C 1: 28,776,956 Q665R possibly damaging Het
Gpr22 C A 12: 31,709,854 V90L probably benign Het
Grip1 G A 10: 120,000,533 V516M probably benign Het
Ipo5 C T 14: 120,923,135 S188L probably benign Het
Kcnh6 T A 11: 106,017,638 I360N possibly damaging Het
Lrp1b C A 2: 41,502,017 D512Y Het
Lrpprc C T 17: 84,752,308 probably null Het
Lta4h A G 10: 93,482,988 K547R probably benign Het
Nacad G C 11: 6,598,948 P1340R possibly damaging Het
Ncapd2 T C 6: 125,179,338 K495E probably benign Het
Ndufaf7 A T 17: 78,938,539 probably null Het
Nsrp1 A G 11: 77,050,651 V77A probably benign Het
Olfr1087 T C 2: 86,690,795 Y60C probably damaging Het
Olfr161 A T 16: 3,593,268 S291C probably damaging Het
P2ry12 A G 3: 59,218,035 V73A probably damaging Het
Pafah1b1 G A 11: 74,683,667 T231I probably benign Het
Parp11 C A 6: 127,471,652 Y77* probably null Het
Phc3 T A 3: 30,929,767 T712S unknown Het
Pkm T A 9: 59,671,937 I335N probably damaging Het
Pmpca A G 2: 26,393,569 T417A probably benign Het
Pot1b C T 17: 55,699,991 probably null Het
Prrc1 T A 18: 57,374,692 probably null Het
Pum3 T A 19: 27,422,391 Y214F probably damaging Het
Reln G A 5: 22,048,038 T637M probably damaging Het
Rpe65 A T 3: 159,615,655 Y368F probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Serpinb3c T A 1: 107,272,001 L263F probably damaging Het
Slc25a23 C T 17: 57,045,553 V444I probably damaging Het
Slc40a1 C T 1: 45,909,461 G553D probably benign Het
Taf7 C A 18: 37,643,170 D115Y probably damaging Het
Tanc1 G C 2: 59,843,422 A1624P probably benign Het
Tmed4 T C 11: 6,274,405 D85G probably benign Het
Tmed6 A G 8: 107,063,753 V138A probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Ttc38 A G 15: 85,836,109 T91A probably benign Het
Ube4b C G 4: 149,360,376 A476P probably benign Het
Vmn2r53 A G 7: 12,581,508 C795R probably benign Het
Zfp979 A G 4: 147,613,166 I362T probably benign Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGAAGGGTTCTGACCTCATGG -3'
(R):5'- AAAGGTGTGCTTAGTACTCAGGAC -3'

Sequencing Primer
(F):5'- TGGTACAGCCCATGTGTGC -3'
(R):5'- AGTACTCAGGACTTTAAAATTGCAG -3'
Posted On 2021-11-19