Mutagenetix > Incidental Mutation

Incidental Mutation 'R9042:Anpep'

687780

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9042 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79838762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 440 (Y440C)

Ref Sequence

ENSEMBL: ENSMUSP00000035943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably damaging
Transcript: ENSMUST00000049004
AA Change: Y440C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: Y440C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107392
AA Change: Y440C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: Y440C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,287,351	I3275T	probably benign	Het
Adamts12	A	G	15: 11,152,048	K208R	probably benign	Het
Amh	T	C	10: 80,806,609	M242T	possibly damaging	Het
Atf7ip	G	T	6: 136,561,265	E499*	probably null	Het
Clasp2	A	G	9: 113,905,997	I967V	probably benign	Het
Cpa6	T	C	1: 10,337,290	T341A	probably benign	Het
Cyp26b1	T	A	6: 84,576,608	Y263F	probably benign	Het
Ecm2	C	A	13: 49,528,963	Y489*	probably null	Het
Gm597	T	C	1: 28,776,956	Q665R	possibly damaging	Het
Gpr22	C	A	12: 31,709,854	V90L	probably benign	Het
Grip1	G	A	10: 120,000,533	V516M	probably benign	Het
Ipo5	C	T	14: 120,923,135	S188L	probably benign	Het
Kcnh6	T	A	11: 106,017,638	I360N	possibly damaging	Het
Lrp1b	C	A	2: 41,502,017	D512Y		Het
Lrpprc	C	T	17: 84,752,308		probably null	Het
Lta4h	A	G	10: 93,482,988	K547R	probably benign	Het
Nacad	G	C	11: 6,598,948	P1340R	possibly damaging	Het
Ncapd2	T	C	6: 125,179,338	K495E	probably benign	Het
Ndufaf7	A	T	17: 78,938,539		probably null	Het
Nsrp1	A	G	11: 77,050,651	V77A	probably benign	Het
Olfr1087	T	C	2: 86,690,795	Y60C	probably damaging	Het
Olfr161	A	T	16: 3,593,268	S291C	probably damaging	Het
P2ry12	A	G	3: 59,218,035	V73A	probably damaging	Het
Pafah1b1	G	A	11: 74,683,667	T231I	probably benign	Het
Parp11	C	A	6: 127,471,652	Y77*	probably null	Het
Phc3	T	A	3: 30,929,767	T712S	unknown	Het
Pkm	T	A	9: 59,671,937	I335N	probably damaging	Het
Pmpca	A	G	2: 26,393,569	T417A	probably benign	Het
Pot1b	C	T	17: 55,699,991		probably null	Het
Prrc1	T	A	18: 57,374,692		probably null	Het
Psg18	A	T	7: 18,349,122	N369K	probably benign	Het
Pum3	T	A	19: 27,422,391	Y214F	probably damaging	Het
Reln	G	A	5: 22,048,038	T637M	probably damaging	Het
Rpe65	A	T	3: 159,615,655	Y368F	probably damaging	Het
Serpina3a	A	G	12: 104,116,103	D45G	probably benign	Het
Serpinb3c	T	A	1: 107,272,001	L263F	probably damaging	Het
Slc25a23	C	T	17: 57,045,553	V444I	probably damaging	Het
Slc40a1	C	T	1: 45,909,461	G553D	probably benign	Het
Taf7	C	A	18: 37,643,170	D115Y	probably damaging	Het
Tanc1	G	C	2: 59,843,422	A1624P	probably benign	Het
Tmed4	T	C	11: 6,274,405	D85G	probably benign	Het
Tmed6	A	G	8: 107,063,753	V138A	probably benign	Het
Tmem63b	T	C	17: 45,666,591	T370A	probably benign	Het
Ttc38	A	G	15: 85,836,109	T91A	probably benign	Het
Ube4b	C	G	4: 149,360,376	A476P	probably benign	Het
Vmn2r53	A	G	7: 12,581,508	C795R	probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
R9769:Anpep	UTSW	7	79838730	missense	probably damaging	1.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGCATTCCCAGAGTGGCAG -3'
(R):5'- TCCTACGTGGAATATCTGGGTGC -3'

Sequencing Primer
(F):5'- TGCCTGAGGGATGCACTC -3'
(R):5'- TGCTGACTATGCAGAGCCTAC -3'

Posted On

2021-11-19