Mutagenetix > Incidental Mutation

Incidental Mutation 'R9042:Clasp2'

687783

Institutional Source

Beutler Lab

Gene Symbol

Clasp2

Ensembl Gene

ENSMUSG00000033392

Gene Name

CLIP associating protein 2

Synonyms

1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9042 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113741473-113919682 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113905997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 967 (I967V)

Ref Sequence

ENSEMBL: ENSMUSP00000107469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111838
AA Change: I967V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: I967V

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	877	2.03e-1	SMART
low complexity region	995	1009	N/A	INTRINSIC
TOG	1043	1274	1.49e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163895
AA Change: I988V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: I988V

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	583	593	N/A	INTRINSIC
low complexity region	635	655	N/A	INTRINSIC
TOG	661	898	2.03e-1	SMART
low complexity region	1016	1030	N/A	INTRINSIC
TOG	1064	1295	1.49e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166734
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: I968V

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	878	7.51e-1	SMART
low complexity region	996	1010	N/A	INTRINSIC
TOG	1044	1275	1.49e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213663

Predicted Effect

probably benign
Transcript: ENSMUST00000214522
AA Change: I985V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215022

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (49/49)

MGI Phenotype

PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,287,351	I3275T	probably benign	Het
Adamts12	A	G	15: 11,152,048	K208R	probably benign	Het
Amh	T	C	10: 80,806,609	M242T	possibly damaging	Het
Anpep	T	C	7: 79,838,762	Y440C	probably damaging	Het
Atf7ip	G	T	6: 136,561,265	E499*	probably null	Het
Cpa6	T	C	1: 10,337,290	T341A	probably benign	Het
Cyp26b1	T	A	6: 84,576,608	Y263F	probably benign	Het
Ecm2	C	A	13: 49,528,963	Y489*	probably null	Het
Gm597	T	C	1: 28,776,956	Q665R	possibly damaging	Het
Gpr22	C	A	12: 31,709,854	V90L	probably benign	Het
Grip1	G	A	10: 120,000,533	V516M	probably benign	Het
Ipo5	C	T	14: 120,923,135	S188L	probably benign	Het
Kcnh6	T	A	11: 106,017,638	I360N	possibly damaging	Het
Lrp1b	C	A	2: 41,502,017	D512Y		Het
Lrpprc	C	T	17: 84,752,308		probably null	Het
Lta4h	A	G	10: 93,482,988	K547R	probably benign	Het
Nacad	G	C	11: 6,598,948	P1340R	possibly damaging	Het
Ncapd2	T	C	6: 125,179,338	K495E	probably benign	Het
Ndufaf7	A	T	17: 78,938,539		probably null	Het
Nsrp1	A	G	11: 77,050,651	V77A	probably benign	Het
Olfr1087	T	C	2: 86,690,795	Y60C	probably damaging	Het
Olfr161	A	T	16: 3,593,268	S291C	probably damaging	Het
P2ry12	A	G	3: 59,218,035	V73A	probably damaging	Het
Pafah1b1	G	A	11: 74,683,667	T231I	probably benign	Het
Parp11	C	A	6: 127,471,652	Y77*	probably null	Het
Phc3	T	A	3: 30,929,767	T712S	unknown	Het
Pkm	T	A	9: 59,671,937	I335N	probably damaging	Het
Pmpca	A	G	2: 26,393,569	T417A	probably benign	Het
Pot1b	C	T	17: 55,699,991		probably null	Het
Prrc1	T	A	18: 57,374,692		probably null	Het
Psg18	A	T	7: 18,349,122	N369K	probably benign	Het
Pum3	T	A	19: 27,422,391	Y214F	probably damaging	Het
Reln	G	A	5: 22,048,038	T637M	probably damaging	Het
Rpe65	A	T	3: 159,615,655	Y368F	probably damaging	Het
Serpina3a	A	G	12: 104,116,103	D45G	probably benign	Het
Serpinb3c	T	A	1: 107,272,001	L263F	probably damaging	Het
Slc25a23	C	T	17: 57,045,553	V444I	probably damaging	Het
Slc40a1	C	T	1: 45,909,461	G553D	probably benign	Het
Taf7	C	A	18: 37,643,170	D115Y	probably damaging	Het
Tanc1	G	C	2: 59,843,422	A1624P	probably benign	Het
Tmed4	T	C	11: 6,274,405	D85G	probably benign	Het
Tmed6	A	G	8: 107,063,753	V138A	probably benign	Het
Tmem63b	T	C	17: 45,666,591	T370A	probably benign	Het
Ttc38	A	G	15: 85,836,109	T91A	probably benign	Het
Ube4b	C	G	4: 149,360,376	A476P	probably benign	Het
Vmn2r53	A	G	7: 12,581,508	C795R	probably benign	Het

Other mutations in Clasp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Clasp2	APN	9	113905992	splice site	probably benign
IGL00885:Clasp2	APN	9	113911416	missense	probably damaging	1.00
IGL01314:Clasp2	APN	9	113906127	missense	possibly damaging	0.89
IGL01344:Clasp2	APN	9	113813292	splice site	probably null
IGL01567:Clasp2	APN	9	113880096	missense	probably damaging	1.00
IGL02238:Clasp2	APN	9	113880020	missense	probably damaging	1.00
IGL02299:Clasp2	APN	9	113879989	missense	probably damaging	1.00
IGL02323:Clasp2	APN	9	113868726	splice site	probably benign
IGL02635:Clasp2	APN	9	113908842	missense	probably damaging	0.98
IGL02645:Clasp2	APN	9	113890061	missense	probably damaging	1.00
IGL02976:Clasp2	APN	9	113906136	missense	probably damaging	1.00
IGL03190:Clasp2	APN	9	113844140	nonsense	probably null
IGL03219:Clasp2	APN	9	113848477	splice site	probably benign
PIT4810001:Clasp2	UTSW	9	113906067	missense	probably damaging	1.00
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0421:Clasp2	UTSW	9	113854302	missense	probably benign	0.02
R0432:Clasp2	UTSW	9	113909419	missense	probably benign	0.00
R0458:Clasp2	UTSW	9	113906224	splice site	probably null
R0865:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R0972:Clasp2	UTSW	9	113847705	missense	possibly damaging	0.58
R1037:Clasp2	UTSW	9	113896634	splice site	probably benign
R1925:Clasp2	UTSW	9	113906197	missense	possibly damaging	0.88
R2015:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R2066:Clasp2	UTSW	9	113906157	missense	possibly damaging	0.86
R2330:Clasp2	UTSW	9	113876304	missense	probably damaging	1.00
R2568:Clasp2	UTSW	9	113878764	missense	probably benign
R3011:Clasp2	UTSW	9	113901513	missense	probably damaging	1.00
R3879:Clasp2	UTSW	9	113889961	missense	probably damaging	0.98
R3915:Clasp2	UTSW	9	113908737	missense	probably damaging	0.99
R3928:Clasp2	UTSW	9	113906105	missense	probably benign	0.28
R4323:Clasp2	UTSW	9	113889959	missense	possibly damaging	0.91
R4571:Clasp2	UTSW	9	113847721	missense	probably damaging	1.00
R4975:Clasp2	UTSW	9	113903916	missense	probably damaging	1.00
R5445:Clasp2	UTSW	9	113903946	missense	probably damaging	1.00
R5564:Clasp2	UTSW	9	113812768	critical splice donor site	probably null
R5697:Clasp2	UTSW	9	113860122	missense	probably benign	0.01
R5780:Clasp2	UTSW	9	113850152	missense	probably damaging	0.99
R5787:Clasp2	UTSW	9	113862242	missense	probably damaging	1.00
R6011:Clasp2	UTSW	9	113876247	missense	probably benign	0.07
R6026:Clasp2	UTSW	9	113911578	missense	probably benign	0.13
R6090:Clasp2	UTSW	9	113852735	missense	probably benign	0.06
R6262:Clasp2	UTSW	9	113876352	critical splice donor site	probably null
R6427:Clasp2	UTSW	9	113892444	missense	probably damaging	1.00
R6464:Clasp2	UTSW	9	113773717	missense	probably damaging	1.00
R6586:Clasp2	UTSW	9	113813264	missense	probably damaging	1.00
R6628:Clasp2	UTSW	9	113896720	missense	probably damaging	1.00
R6745:Clasp2	UTSW	9	113875270	nonsense	probably null
R7032:Clasp2	UTSW	9	113854323	missense	probably benign	0.04
R7165:Clasp2	UTSW	9	113786399	splice site	probably null
R7221:Clasp2	UTSW	9	113852757	missense	probably damaging	0.99
R7336:Clasp2	UTSW	9	113876353	splice site	probably null
R7583:Clasp2	UTSW	9	113908687	missense	probably benign	0.02
R7774:Clasp2	UTSW	9	113848736	splice site	probably null
R7895:Clasp2	UTSW	9	113903948	missense	probably benign	0.03
R8084:Clasp2	UTSW	9	113847755	missense	probably benign	0.16
R8109:Clasp2	UTSW	9	113911520	missense	probably damaging	1.00
R8171:Clasp2	UTSW	9	113903906	missense	possibly damaging	0.88
R8230:Clasp2	UTSW	9	113892414	missense	possibly damaging	0.73
R8810:Clasp2	UTSW	9	113899581	missense	probably damaging	1.00
R8879:Clasp2	UTSW	9	113773705	missense	probably benign	0.39
R8888:Clasp2	UTSW	9	113903868	missense	possibly damaging	0.54
R8889:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8892:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8922:Clasp2	UTSW	9	113896660	nonsense	probably null
R9195:Clasp2	UTSW	9	113841977	missense	probably benign	0.06
R9355:Clasp2	UTSW	9	113835241	missense	probably damaging	1.00
R9481:Clasp2	UTSW	9	113841601	missense	probably damaging	1.00
R9502:Clasp2	UTSW	9	113908798	missense	probably benign	0.01
R9523:Clasp2	UTSW	9	113876304	missense	probably damaging	0.98
R9525:Clasp2	UTSW	9	113911609	missense	probably damaging	1.00
R9653:Clasp2	UTSW	9	113841925	missense	probably benign	0.01
R9699:Clasp2	UTSW	9	113909546	critical splice donor site	probably null
R9738:Clasp2	UTSW	9	113761597	nonsense	probably null
R9775:Clasp2	UTSW	9	113896672	missense	probably benign
X0022:Clasp2	UTSW	9	113852672	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113770221	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113908795	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTGGGTAGCTCATCTGCTG -3'
(R):5'- GCAGACTTGTTGAAAGGACTG -3'

Sequencing Primer
(F):5'- TGGGAATTTCACATCAGGCATCC -3'
(R):5'- GACTTGTTGAAAGGACTGATGCTATC -3'

Posted On

2021-11-19