Incidental Mutation 'R9043:Cfap65'
ID 687809
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R9043 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74904688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1555 (T1555S)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000094844
AA Change: T1555S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T1555S

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik T A 8: 87,582,610 S134T possibly damaging Het
Aadacl4 T A 4: 144,623,220 L349Q probably damaging Het
Ankrd29 T C 18: 12,295,913 N33S probably damaging Het
Arid3b T C 9: 57,792,617 S536G possibly damaging Het
Art5 A C 7: 102,099,492 M1R probably null Het
Arvcf T A 16: 18,399,702 C545S probably damaging Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
BC037034 G A 5: 138,261,627 T389I possibly damaging Het
Cdh23 T G 10: 60,315,699 D2469A probably benign Het
Cep350 T A 1: 155,897,482 T1781S probably damaging Het
Chga G A 12: 102,562,795 E344K possibly damaging Het
Ckap2l A T 2: 129,284,972 L429M probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cyp2g1 A G 7: 26,809,831 N110S probably benign Het
Cyp3a11 T C 5: 145,869,185 D124G probably benign Het
Dgkq A T 5: 108,653,195 V527D probably damaging Het
Dnah3 T C 7: 119,952,049 I37V probably benign Het
Dnah9 T A 11: 65,954,854 E3068V Het
Dusp23 T C 1: 172,632,617 E89G probably null Het
Fam173b A G 15: 31,616,955 T189A probably benign Het
Fam187a A G 11: 102,885,859 Y163C possibly damaging Het
Fam19a2 T C 10: 123,704,389 V50A probably damaging Het
Gabrg2 T A 11: 41,974,835 I106F probably damaging Het
Gpc2 A G 5: 138,278,931 I78T probably benign Het
Gpr149 A C 3: 62,603,939 L213R probably damaging Het
Grm1 A T 10: 10,689,312 L1084* probably null Het
Gypa A G 8: 80,496,317 T17A unknown Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Iqce A T 5: 140,666,055 M721K probably benign Het
Klrc2 T A 6: 129,658,778 Y129F probably damaging Het
Krt14 T C 11: 100,204,638 S314G possibly damaging Het
L3mbtl3 T C 10: 26,280,254 Q685R unknown Het
Lamb3 A T 1: 193,325,611 K206* probably null Het
Lgr5 A G 10: 115,478,438 I198T probably damaging Het
Mapk10 A T 5: 102,926,159 probably benign Het
Mcm6 C T 1: 128,343,494 D463N probably damaging Het
Med15 A T 16: 17,652,718 W742R probably benign Het
Meis1 T A 11: 18,881,916 Q374L possibly damaging Het
Nrxn3 T C 12: 89,260,482 C296R probably damaging Het
Oaf C T 9: 43,224,011 A157T probably damaging Het
Oca2 T A 7: 56,277,441 probably null Het
Olfr1163 T A 2: 88,070,639 T248S possibly damaging Het
Olfr1448 T A 19: 12,920,303 E2V probably benign Het
Olfr1464-ps1 A T 19: 13,282,710 M116K probably damaging Het
Olfr826 A T 10: 130,180,285 H198Q probably benign Het
Pacs1 A G 19: 5,138,936 I806T probably benign Het
Pax2 T A 19: 44,816,060 S257T probably benign Het
Pbxip1 A T 3: 89,443,487 T72S probably benign Het
Pcdhb14 T C 18: 37,448,798 I319T probably damaging Het
Pcdhga2 C A 18: 37,669,910 A269E possibly damaging Het
Pdzph1 A C 17: 58,973,540 N582K probably benign Het
Plk2 A T 13: 110,396,660 I186F probably damaging Het
Pzp A T 6: 128,494,779 C895S probably damaging Het
Rasa2 A T 9: 96,602,717 V148D probably damaging Het
Rgsl1 A T 1: 153,841,821 I14N possibly damaging Het
Rhox3c C T X: 37,469,650 probably benign Het
Rnf213 A G 11: 119,458,913 R3867G Het
Rpap3 A G 15: 97,686,562 Y334H possibly damaging Het
Scara3 A C 14: 65,931,621 N182K probably damaging Het
Sh3bp1 A G 15: 78,907,249 E412G possibly damaging Het
Sh3tc2 T A 18: 61,989,890 I574N possibly damaging Het
Slc16a11 T C 11: 70,215,694 Y253H probably damaging Het
Slc38a4 A T 15: 97,008,924 V311E possibly damaging Het
Slc4a7 T C 14: 14,775,048 L826P probably damaging Het
Spag9 T G 11: 94,060,259 V83G Het
Sspo T G 6: 48,493,280 V4560G probably benign Het
Stxbp2 T A 8: 3,634,478 F144I Het
Tdh T C 14: 63,492,829 I334V probably benign Het
Tesk2 C A 4: 116,802,951 S451Y probably benign Het
Tjp1 A T 7: 65,312,931 V1166E probably benign Het
Tmeff2 G A 1: 50,979,620 V254M unknown Het
Tmem126a A G 7: 90,451,541 probably null Het
Togaram2 C G 17: 71,686,704 P2A probably benign Het
Tssk4 C T 14: 55,651,754 R246W probably damaging Het
Tubal3 C T 13: 3,932,708 R163* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vezt T C 10: 93,984,165 N446S probably damaging Het
Vim A T 2: 13,574,438 T3S unknown Het
Vmn2r45 A G 7: 8,471,905 L708P possibly damaging Het
Wdyhv1 A G 15: 58,150,608 Y67C possibly damaging Het
Yes1 A G 5: 32,652,968 Y157C probably damaging Het
Zfp358 A G 8: 3,495,810 T131A probably benign Het
Zfp426 C T 9: 20,475,012 V58M probably damaging Het
Zfp692 T C 11: 58,307,724 S47P probably damaging Het
Zfp719 A T 7: 43,590,181 T398S possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGAGTGTGGACATCTG -3'
(R):5'- ACTGACAATGGGATTATAGCTGC -3'

Sequencing Primer
(F):5'- AGTGTGGACATCTGCTGCTCTAC -3'
(R):5'- GACAATGGGATTATAGCTGCCCTAC -3'
Posted On 2021-11-19