Incidental Mutation 'R9043:Cyp2g1'
ID 687836
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9043 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26808892-26821205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26809831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 110 (N110S)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably benign
Transcript: ENSMUST00000040944
AA Change: N110S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: N110S

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik T A 8: 87,582,610 S134T possibly damaging Het
Aadacl4 T A 4: 144,623,220 L349Q probably damaging Het
Ankrd29 T C 18: 12,295,913 N33S probably damaging Het
Arid3b T C 9: 57,792,617 S536G possibly damaging Het
Art5 A C 7: 102,099,492 M1R probably null Het
Arvcf T A 16: 18,399,702 C545S probably damaging Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
BC037034 G A 5: 138,261,627 T389I possibly damaging Het
Cdh23 T G 10: 60,315,699 D2469A probably benign Het
Cep350 T A 1: 155,897,482 T1781S probably damaging Het
Cfap65 T A 1: 74,904,688 T1555S possibly damaging Het
Chga G A 12: 102,562,795 E344K possibly damaging Het
Ckap2l A T 2: 129,284,972 L429M probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cyp3a11 T C 5: 145,869,185 D124G probably benign Het
Dgkq A T 5: 108,653,195 V527D probably damaging Het
Dnah3 T C 7: 119,952,049 I37V probably benign Het
Dnah9 T A 11: 65,954,854 E3068V Het
Dusp23 T C 1: 172,632,617 E89G probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Fam173b A G 15: 31,616,955 T189A probably benign Het
Fam187a A G 11: 102,885,859 Y163C possibly damaging Het
Fam19a2 T C 10: 123,704,389 V50A probably damaging Het
Gabrg2 T A 11: 41,974,835 I106F probably damaging Het
Gpc2 A G 5: 138,278,931 I78T probably benign Het
Gpr149 A C 3: 62,603,939 L213R probably damaging Het
Grm1 A T 10: 10,689,312 L1084* probably null Het
Gypa A G 8: 80,496,317 T17A unknown Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqce A T 5: 140,666,055 M721K probably benign Het
Klrc2 T A 6: 129,658,778 Y129F probably damaging Het
Krt14 T C 11: 100,204,638 S314G possibly damaging Het
L3mbtl3 T C 10: 26,280,254 Q685R unknown Het
Lamb3 A T 1: 193,325,611 K206* probably null Het
Lgr5 A G 10: 115,478,438 I198T probably damaging Het
Mcm6 C T 1: 128,343,494 D463N probably damaging Het
Med15 A T 16: 17,652,718 W742R probably benign Het
Meis1 T A 11: 18,881,916 Q374L possibly damaging Het
Nrxn3 T C 12: 89,260,482 C296R probably damaging Het
Oaf C T 9: 43,224,011 A157T probably damaging Het
Oca2 T A 7: 56,277,441 probably null Het
Olfr1163 T A 2: 88,070,639 T248S possibly damaging Het
Olfr1448 T A 19: 12,920,303 E2V probably benign Het
Olfr1464-ps1 A T 19: 13,282,710 M116K probably damaging Het
Olfr826 A T 10: 130,180,285 H198Q probably benign Het
Pacs1 A G 19: 5,138,936 I806T probably benign Het
Pax2 T A 19: 44,816,060 S257T probably benign Het
Pbxip1 A T 3: 89,443,487 T72S probably benign Het
Pcdhb14 T C 18: 37,448,798 I319T probably damaging Het
Pcdhga2 C A 18: 37,669,910 A269E possibly damaging Het
Pdzph1 A C 17: 58,973,540 N582K probably benign Het
Plk2 A T 13: 110,396,660 I186F probably damaging Het
Pzp A T 6: 128,494,779 C895S probably damaging Het
Rasa2 A T 9: 96,602,717 V148D probably damaging Het
Rgsl1 A T 1: 153,841,821 I14N possibly damaging Het
Rhox3c C T X: 37,469,650 probably benign Het
Rnf213 A G 11: 119,458,913 R3867G Het
Rpap3 A G 15: 97,686,562 Y334H possibly damaging Het
Scara3 A C 14: 65,931,621 N182K probably damaging Het
Sh3bp1 A G 15: 78,907,249 E412G possibly damaging Het
Sh3tc2 T A 18: 61,989,890 I574N possibly damaging Het
Slc16a11 T C 11: 70,215,694 Y253H probably damaging Het
Slc38a4 A T 15: 97,008,924 V311E possibly damaging Het
Slc4a7 T C 14: 14,775,048 L826P probably damaging Het
Spag9 T G 11: 94,060,259 V83G Het
Sspo T G 6: 48,493,280 V4560G probably benign Het
Stxbp2 T A 8: 3,634,478 F144I Het
Tdh T C 14: 63,492,829 I334V probably benign Het
Tesk2 C A 4: 116,802,951 S451Y probably benign Het
Tjp1 A T 7: 65,312,931 V1166E probably benign Het
Tmeff2 G A 1: 50,979,620 V254M unknown Het
Tmem126a A G 7: 90,451,541 probably null Het
Togaram2 C G 17: 71,686,704 P2A probably benign Het
Tssk4 C T 14: 55,651,754 R246W probably damaging Het
Tubal3 C T 13: 3,932,708 R163* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vezt T C 10: 93,984,165 N446S probably damaging Het
Vim A T 2: 13,574,438 T3S unknown Het
Vmn2r45 A G 7: 8,471,905 L708P possibly damaging Het
Wdyhv1 A G 15: 58,150,608 Y67C possibly damaging Het
Yes1 A G 5: 32,652,968 Y157C probably damaging Het
Zfp358 A G 8: 3,495,810 T131A probably benign Het
Zfp426 C T 9: 20,475,012 V58M probably damaging Het
Zfp692 T C 11: 58,307,724 S47P probably damaging Het
Zfp719 A T 7: 43,590,181 T398S possibly damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26809831 missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26814259 missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26814294 splice site probably benign
IGL02338:Cyp2g1 APN 7 26814804 splice site probably benign
IGL02452:Cyp2g1 APN 7 26811446 missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26819187 missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26809776 missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26819403 missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26814194 missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26814295 splice site probably benign
R0697:Cyp2g1 UTSW 7 26814727 nonsense probably null
R0830:Cyp2g1 UTSW 7 26814791 missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26809682 critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26819433 missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26820710 missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26814154 missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26820801 missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26820740 missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26816640 missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26814179 missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26820759 missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26814632 missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26819193 missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26819461 missense probably benign
R8177:Cyp2g1 UTSW 7 26819153 missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26814734 missense possibly damaging 0.89
R9406:Cyp2g1 UTSW 7 26819485 critical splice donor site probably null
X0067:Cyp2g1 UTSW 7 26820762 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACACAGCTCTGTCATGCTCC -3'
(R):5'- CTGCCCTCAAACATACTGTGC -3'

Sequencing Primer
(F):5'- ACAGCTCTGTCATGCTCCAATTTAC -3'
(R):5'- ACTGTGCAACACTATCTAACCTTTC -3'
Posted On 2021-11-19