Incidental Mutation 'R9044:Eef2k'
ID 687919
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9044 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120880361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 167 (V167E)
Ref Sequence ENSEMBL: ENSMUSP00000046595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143322]
AlphaFold O08796
Predicted Effect probably damaging
Transcript: ENSMUST00000047875
AA Change: V167E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: V167E

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106488
AA Change: V167E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: V167E

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106489
AA Change: V167E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: V167E

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143322
SMART Domains Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 6e-15 BLAST
Blast:Alpha_kinase 120 160 1e-21 BLAST
SCOP:d1ia9a_ 129 160 3e-7 SMART
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,066,480 Y667* probably null Het
5830411N06Rik G T 7: 140,248,097 G73C probably damaging Het
Acacb A G 5: 114,235,517 H1869R probably benign Het
Adgrb1 A G 15: 74,569,899 T950A possibly damaging Het
Alms1 T A 6: 85,696,753 L3110Q probably damaging Het
Ambra1 A T 2: 91,910,089 probably benign Het
Brpf3 A T 17: 28,806,897 N315Y possibly damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cyba T A 8: 122,424,891 D189V probably benign Het
Dexi A G 16: 10,503,521 probably benign Het
Dnah2 C T 11: 69,529,421 V156I probably benign Het
Drc7 T C 8: 95,070,449 V420A probably damaging Het
Efcab1 A G 16: 14,920,397 D142G probably damaging Het
Eid2 T C 7: 28,268,613 I220T possibly damaging Het
Fggy A C 4: 95,844,097 T442P probably benign Het
Foxi3 T G 6: 70,956,699 S57A probably benign Het
Foxi3 T A 6: 70,957,202 probably null Het
Galntl5 C T 5: 25,210,328 P286S possibly damaging Het
Gm5592 A G 7: 41,288,850 K519E probably benign Het
Gse1 T A 8: 120,230,530 S587T unknown Het
Kcns1 G T 2: 164,168,076 F254L probably damaging Het
Kif15 A G 9: 123,011,716 T23A probably benign Het
Kif16b T C 2: 142,699,657 Q1241R possibly damaging Het
Lck A T 4: 129,556,305 L205Q probably damaging Het
Map9 C T 3: 82,380,218 A420V possibly damaging Het
Mdm2 A T 10: 117,695,055 D170E Het
Mllt6 T A 11: 97,663,659 C30S probably damaging Het
Muc5b T G 7: 141,858,058 D1580E unknown Het
Oaf C T 9: 43,224,011 A157T probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr324 T A 11: 58,598,300 N295K possibly damaging Het
Olfr525 A G 7: 140,322,572 probably benign Het
Osbp2 T C 11: 3,717,128 I8V probably damaging Het
Pcdh9 T C 14: 93,886,811 Y641C probably damaging Het
Phf10 A T 17: 14,946,322 C429S probably damaging Het
Plekha6 C G 1: 133,273,949 P367A probably benign Het
Plekha6 C A 1: 133,273,950 P367Q possibly damaging Het
Plod2 T A 9: 92,607,220 I756K probably damaging Het
Plxnb2 C A 15: 89,160,363 probably benign Het
Pop1 T A 15: 34,530,408 M1014K possibly damaging Het
Prrt4 T C 6: 29,171,541 D304G probably benign Het
Rcan2 C A 17: 43,836,354 L28I probably benign Het
Rffl C T 11: 82,810,194 V269I probably benign Het
Rhox3c C T X: 37,469,650 probably benign Het
Ric1 C T 19: 29,599,894 A1066V probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr2 A T 13: 11,738,103 Y1777* probably null Het
Sh3tc1 T G 5: 35,697,490 K1288Q possibly damaging Het
Slc10a5 A C 3: 10,334,732 I289M probably damaging Het
Slc16a9 A G 10: 70,274,967 T128A probably benign Het
Slc7a11 T C 3: 50,379,183 H373R probably benign Het
Spesp1 A G 9: 62,273,341 I95T probably benign Het
Sra1 C T 18: 36,667,893 V131I probably benign Het
Stxbp5l A G 16: 37,204,568 V556A possibly damaging Het
Sycp2 T C 2: 178,347,824 E1414G probably damaging Het
Trac A T 14: 54,220,691 K57* probably null Het
Trps1 T C 15: 50,822,607 E724G probably benign Het
Tubgcp6 T G 15: 89,103,194 D1192A possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vps18 T G 2: 119,297,553 I952M probably damaging Het
Wdr36 T C 18: 32,837,446 F20S probably damaging Het
Wdr62 C A 7: 30,262,637 R450L probably benign Het
Xab2 T C 8: 3,618,641 K76E probably benign Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGACACTGGTCCTTCCC -3'
(R):5'- CTGTGTTTCACCCTGGTGGC -3'

Sequencing Primer
(F):5'- CCTCTGACTCTGGGTGGAG -3'
(R):5'- CACCCTGGTGGCTGGCC -3'
Posted On 2021-11-19