Incidental Mutation 'R9044:5830411N06Rik'
ID 687920
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9044 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140248097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 73 (G73C)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably damaging
Transcript: ENSMUST00000093984
AA Change: G73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: G73C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164583
AA Change: G73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: G73C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,066,480 Y667* probably null Het
Acacb A G 5: 114,235,517 H1869R probably benign Het
Adgrb1 A G 15: 74,569,899 T950A possibly damaging Het
Alms1 T A 6: 85,696,753 L3110Q probably damaging Het
Ambra1 A T 2: 91,910,089 probably benign Het
Brpf3 A T 17: 28,806,897 N315Y possibly damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cyba T A 8: 122,424,891 D189V probably benign Het
Dexi A G 16: 10,503,521 probably benign Het
Dnah2 C T 11: 69,529,421 V156I probably benign Het
Drc7 T C 8: 95,070,449 V420A probably damaging Het
Eef2k T A 7: 120,880,361 V167E probably damaging Het
Efcab1 A G 16: 14,920,397 D142G probably damaging Het
Eid2 T C 7: 28,268,613 I220T possibly damaging Het
Fggy A C 4: 95,844,097 T442P probably benign Het
Foxi3 T G 6: 70,956,699 S57A probably benign Het
Foxi3 T A 6: 70,957,202 probably null Het
Galntl5 C T 5: 25,210,328 P286S possibly damaging Het
Gm5592 A G 7: 41,288,850 K519E probably benign Het
Gse1 T A 8: 120,230,530 S587T unknown Het
Kcns1 G T 2: 164,168,076 F254L probably damaging Het
Kif15 A G 9: 123,011,716 T23A probably benign Het
Kif16b T C 2: 142,699,657 Q1241R possibly damaging Het
Lck A T 4: 129,556,305 L205Q probably damaging Het
Map9 C T 3: 82,380,218 A420V possibly damaging Het
Mdm2 A T 10: 117,695,055 D170E Het
Mllt6 T A 11: 97,663,659 C30S probably damaging Het
Muc5b T G 7: 141,858,058 D1580E unknown Het
Oaf C T 9: 43,224,011 A157T probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr324 T A 11: 58,598,300 N295K possibly damaging Het
Olfr525 A G 7: 140,322,572 probably benign Het
Osbp2 T C 11: 3,717,128 I8V probably damaging Het
Pcdh9 T C 14: 93,886,811 Y641C probably damaging Het
Phf10 A T 17: 14,946,322 C429S probably damaging Het
Plekha6 C G 1: 133,273,949 P367A probably benign Het
Plekha6 C A 1: 133,273,950 P367Q possibly damaging Het
Plod2 T A 9: 92,607,220 I756K probably damaging Het
Plxnb2 C A 15: 89,160,363 probably benign Het
Pop1 T A 15: 34,530,408 M1014K possibly damaging Het
Prrt4 T C 6: 29,171,541 D304G probably benign Het
Rcan2 C A 17: 43,836,354 L28I probably benign Het
Rffl C T 11: 82,810,194 V269I probably benign Het
Rhox3c C T X: 37,469,650 probably benign Het
Ric1 C T 19: 29,599,894 A1066V probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr2 A T 13: 11,738,103 Y1777* probably null Het
Sh3tc1 T G 5: 35,697,490 K1288Q possibly damaging Het
Slc10a5 A C 3: 10,334,732 I289M probably damaging Het
Slc16a9 A G 10: 70,274,967 T128A probably benign Het
Slc7a11 T C 3: 50,379,183 H373R probably benign Het
Spesp1 A G 9: 62,273,341 I95T probably benign Het
Sra1 C T 18: 36,667,893 V131I probably benign Het
Stxbp5l A G 16: 37,204,568 V556A possibly damaging Het
Sycp2 T C 2: 178,347,824 E1414G probably damaging Het
Trac A T 14: 54,220,691 K57* probably null Het
Trps1 T C 15: 50,822,607 E724G probably benign Het
Tubgcp6 T G 15: 89,103,194 D1192A possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vps18 T G 2: 119,297,553 I952M probably damaging Het
Wdr36 T C 18: 32,837,446 F20S probably damaging Het
Wdr62 C A 7: 30,262,637 R450L probably benign Het
Xab2 T C 8: 3,618,641 K76E probably benign Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGTCTAATTTTGAAGCATTCC -3'
(R):5'- GAGCAGGTAATCACAGCCAC -3'

Sequencing Primer
(F):5'- TTTGAAGCATTCCAAATGAAATACAG -3'
(R):5'- CACACTGGCATTTGCAGC -3'
Posted On 2021-11-19