Incidental Mutation 'R9045:Cr2'
ID 687961
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 068872-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9045 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194837680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 763 (N763K)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: N763K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: N763K

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193356
AA Change: N466K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: N466K

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195120
AA Change: N763K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: N763K

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210219
AA Change: N1139K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A C 8: 33,919,362 (GRCm39) M61L Het
9130401M01Rik G T 15: 57,892,130 (GRCm39) A223E possibly damaging Het
Adgra1 T G 7: 139,432,566 (GRCm39) L135V possibly damaging Het
Aida A G 1: 183,094,940 (GRCm39) E127G possibly damaging Het
Ankrd31 T A 13: 96,968,034 (GRCm39) L557* probably null Het
Atxn7l3 T A 11: 102,183,272 (GRCm39) T221S probably damaging Het
Bbs7 A G 3: 36,666,184 (GRCm39) S27P probably benign Het
Cela3b A T 4: 137,152,110 (GRCm39) C116S possibly damaging Het
Clstn3 A C 6: 124,408,921 (GRCm39) M909R probably damaging Het
Cnot2 T C 10: 116,322,160 (GRCm39) E523G probably benign Het
Col12a1 T A 9: 79,582,034 (GRCm39) T1406S probably benign Het
Csmd1 A G 8: 16,284,088 (GRCm39) F557L probably damaging Het
Cyth1 T C 11: 118,073,090 (GRCm39) H270R possibly damaging Het
Epg5 T C 18: 77,992,014 (GRCm39) L237P probably damaging Het
Fbxo36 G A 1: 84,874,300 (GRCm39) D99N probably damaging Het
Fcgbpl1 T A 7: 27,853,856 (GRCm39) C1607S probably damaging Het
Flot2 A G 11: 77,950,023 (GRCm39) I417M probably benign Het
Fryl A G 5: 73,182,118 (GRCm39) L143P Het
Gckr A G 5: 31,457,353 (GRCm39) N122S possibly damaging Het
Gm3250 T A 10: 77,617,932 (GRCm39) T149S unknown Het
Golga3 G A 5: 110,340,963 (GRCm39) M552I probably benign Het
Grip1 T A 10: 119,871,356 (GRCm39) D694E probably damaging Het
Heatr1 T C 13: 12,428,233 (GRCm39) V790A probably benign Het
Ighv1-54 G A 12: 115,157,500 (GRCm39) T49I probably benign Het
Iglv1 A G 16: 18,904,053 (GRCm39) V22A probably benign Het
Lama1 A T 17: 68,060,838 (GRCm39) Y722F Het
Laptm5 A T 4: 130,655,955 (GRCm39) E91V Het
Lrig1 A G 6: 94,585,688 (GRCm39) probably null Het
Mcph1 T G 8: 18,682,443 (GRCm39) S527A probably benign Het
Med13l G T 5: 118,880,816 (GRCm39) V1303L probably benign Het
Mindy4 A G 6: 55,295,283 (GRCm39) D741G probably benign Het
Myo15b T A 11: 115,783,178 (GRCm39) *3034R probably null Het
Nfkbie A T 17: 45,872,959 (GRCm39) K354I probably damaging Het
Npat A G 9: 53,474,776 (GRCm39) N856S possibly damaging Het
Nr2c2ap A G 8: 70,585,808 (GRCm39) D122G probably damaging Het
Nr4a3 C A 4: 48,067,694 (GRCm39) T430K possibly damaging Het
Or12e10 C A 2: 87,640,416 (GRCm39) S84Y probably damaging Het
Or52ab4 T G 7: 102,987,903 (GRCm39) I214R probably damaging Het
Or5h25 A G 16: 58,930,365 (GRCm39) S203P probably benign Het
Otud7b A G 3: 96,059,895 (GRCm39) K397E probably benign Het
Pafah1b3 G T 7: 24,996,898 (GRCm39) probably benign Het
Pcdhgc3 G T 18: 37,940,669 (GRCm39) V357L probably damaging Het
Pde2a A G 7: 101,152,498 (GRCm39) T354A unknown Het
Pira12 A G 7: 3,897,547 (GRCm39) I516T possibly damaging Het
Rbfa T C 18: 80,236,026 (GRCm39) H241R probably damaging Het
Rhox3c C T X: 36,651,303 (GRCm39) probably benign Het
Rps6ka1 C T 4: 133,600,150 (GRCm39) probably benign Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Sbno1 A G 5: 124,543,720 (GRCm39) V273A probably benign Het
Scg3 T C 9: 75,570,522 (GRCm39) N344S probably damaging Het
Serpinb1c C G 13: 33,066,027 (GRCm39) G306A probably benign Het
Sh2d6 C T 6: 72,492,604 (GRCm39) G206D probably benign Het
Slamf9 G A 1: 172,304,938 (GRCm39) S184N probably damaging Het
Slc50a1 T C 3: 89,176,042 (GRCm39) T168A probably damaging Het
Tas2r124 G C 6: 132,732,034 (GRCm39) W114C probably damaging Het
Tgm4 C T 9: 122,877,616 (GRCm39) T206I possibly damaging Het
Tmem52 A G 4: 155,553,899 (GRCm39) probably null Het
Vmn2r102 A G 17: 19,880,841 (GRCm39) K61E probably benign Het
Vmn2r58 T C 7: 41,487,087 (GRCm39) I603V probably benign Het
Vstm2l G T 2: 157,756,795 (GRCm39) G22V unknown Het
Vwa5b1 T A 4: 138,315,990 (GRCm39) Y584F probably damaging Het
Wdfy3 A T 5: 101,995,040 (GRCm39) V3233D probably damaging Het
Wdhd1 A G 14: 47,511,409 (GRCm39) V101A probably benign Het
Zfc3h1 C A 10: 115,263,319 (GRCm39) Q1761K possibly damaging Het
Zfp180 G A 7: 23,804,315 (GRCm39) V245I probably benign Het
Zfp846 A T 9: 20,505,189 (GRCm39) I350L probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CATGATGAAGCCTTGATTGCAGAC -3'
(R):5'- AGCATGCTCTAGTTTCCAAACC -3'

Sequencing Primer
(F):5'- GCCTTGATTGCAGACAAAATGTAC -3'
(R):5'- CATGCTCTAGTTTCCAAACCTTAAAC -3'
Posted On 2021-11-19