Incidental Mutation 'R9045:Golga3'
ID 687975
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9045 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110193097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 552 (M552I)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: M592I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: M592I

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: M552I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: M552I

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A C 8: 33,429,334 M61L Het
9130401M01Rik G T 15: 58,028,734 A223E possibly damaging Het
9530053A07Rik T A 7: 28,154,431 C1607S probably damaging Het
Adgra1 T G 7: 139,852,650 L135V possibly damaging Het
Aida A G 1: 183,314,005 E127G possibly damaging Het
Ankrd31 T A 13: 96,831,526 L557* probably null Het
Atxn7l3 T A 11: 102,292,446 T221S probably damaging Het
Bbs7 A G 3: 36,612,035 S27P probably benign Het
Cela3b A T 4: 137,424,799 C116S possibly damaging Het
Clstn3 A C 6: 124,431,962 M909R probably damaging Het
Cnot2 T C 10: 116,486,255 E523G probably benign Het
Col12a1 T A 9: 79,674,752 T1406S probably benign Het
Cr2 A T 1: 195,155,372 N763K possibly damaging Het
Csmd1 A G 8: 16,234,074 F557L probably damaging Het
Cyth1 T C 11: 118,182,264 H270R possibly damaging Het
Epg5 T C 18: 77,948,799 L237P probably damaging Het
Fbxo36 G A 1: 84,896,579 D99N probably damaging Het
Flot2 A G 11: 78,059,197 I417M probably benign Het
Fryl A G 5: 73,024,775 L143P Het
Gckr A G 5: 31,300,009 N122S possibly damaging Het
Gm14548 A G 7: 3,894,548 I516T possibly damaging Het
Gm3250 T A 10: 77,782,098 T149S unknown Het
Grip1 T A 10: 120,035,451 D694E probably damaging Het
Heatr1 T C 13: 12,413,352 V790A probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Ighv1-54 G A 12: 115,193,880 T49I probably benign Het
Iglv1 A G 16: 19,085,303 V22A probably benign Het
Lama1 A T 17: 67,753,843 Y722F Het
Laptm5 A T 4: 130,928,644 E91V Het
Lrig1 A G 6: 94,608,707 probably null Het
Mcph1 T G 8: 18,632,427 S527A probably benign Het
Med13l G T 5: 118,742,751 V1303L probably benign Het
Mindy4 A G 6: 55,318,298 D741G probably benign Het
Nfkbie A T 17: 45,562,033 K354I probably damaging Het
Npat A G 9: 53,563,476 N856S possibly damaging Het
Nr2c2ap A G 8: 70,133,158 D122G probably damaging Het
Nr4a3 C A 4: 48,067,694 T430K possibly damaging Het
Olfr1145 C A 2: 87,810,072 S84Y probably damaging Het
Olfr193 A G 16: 59,110,002 S203P probably benign Het
Olfr599 T G 7: 103,338,696 I214R probably damaging Het
Otud7b A G 3: 96,152,578 K397E probably benign Het
Pcdhgc3 G T 18: 37,807,616 V357L probably damaging Het
Pde2a A G 7: 101,503,291 T354A unknown Het
Rbfa T C 18: 80,192,811 H241R probably damaging Het
Rhox3c C T X: 37,469,650 probably benign Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sbno1 A G 5: 124,405,657 V273A probably benign Het
Scg3 T C 9: 75,663,240 N344S probably damaging Het
Serpinb1c C G 13: 32,882,044 G306A probably benign Het
Sh2d6 C T 6: 72,515,621 G206D probably benign Het
Slamf9 G A 1: 172,477,371 S184N probably damaging Het
Slc50a1 T C 3: 89,268,735 T168A probably damaging Het
Tas2r124 G C 6: 132,755,071 W114C probably damaging Het
Tgm4 C T 9: 123,048,551 T206I possibly damaging Het
Tmem52 A G 4: 155,469,442 probably null Het
Vmn2r102 A G 17: 19,660,579 K61E probably benign Het
Vmn2r58 T C 7: 41,837,663 I603V probably benign Het
Vstm2l G T 2: 157,914,875 G22V unknown Het
Vwa5b1 T A 4: 138,588,679 Y584F probably damaging Het
Wdfy3 A T 5: 101,847,174 V3233D probably damaging Het
Wdhd1 A G 14: 47,273,952 V101A probably benign Het
Zfc3h1 C A 10: 115,427,414 Q1761K possibly damaging Het
Zfp180 G A 7: 24,104,890 V245I probably benign Het
Zfp846 A T 9: 20,593,893 I350L probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGATGACAGCGCTACAGAGC -3'
(R):5'- AAGTCCATGAAATGTGGGTCTG -3'

Sequencing Primer
(F):5'- GCTACAGAGCCAGCTCCAG -3'
(R):5'- GGTGTGGTCAAAGAAAAATTTGTCC -3'
Posted On 2021-11-19