Mutagenetix > Incidental Mutation

Incidental Mutation 'R9045:Golga3'

687975

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

068872-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9045 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110193097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 552 (M552I)

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031477
AA Change: M592I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: M592I

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112512
AA Change: M552I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: M552I

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5930422O12Rik	A	C	8: 33,429,334	M61L		Het
9130401M01Rik	G	T	15: 58,028,734	A223E	possibly damaging	Het
9530053A07Rik	T	A	7: 28,154,431	C1607S	probably damaging	Het
Adgra1	T	G	7: 139,852,650	L135V	possibly damaging	Het
Aida	A	G	1: 183,314,005	E127G	possibly damaging	Het
Ankrd31	T	A	13: 96,831,526	L557*	probably null	Het
Atxn7l3	T	A	11: 102,292,446	T221S	probably damaging	Het
Bbs7	A	G	3: 36,612,035	S27P	probably benign	Het
Cela3b	A	T	4: 137,424,799	C116S	possibly damaging	Het
Clstn3	A	C	6: 124,431,962	M909R	probably damaging	Het
Cnot2	T	C	10: 116,486,255	E523G	probably benign	Het
Col12a1	T	A	9: 79,674,752	T1406S	probably benign	Het
Cr2	A	T	1: 195,155,372	N763K	possibly damaging	Het
Csmd1	A	G	8: 16,234,074	F557L	probably damaging	Het
Cyth1	T	C	11: 118,182,264	H270R	possibly damaging	Het
Epg5	T	C	18: 77,948,799	L237P	probably damaging	Het
Fbxo36	G	A	1: 84,896,579	D99N	probably damaging	Het
Flot2	A	G	11: 78,059,197	I417M	probably benign	Het
Fryl	A	G	5: 73,024,775	L143P		Het
Gckr	A	G	5: 31,300,009	N122S	possibly damaging	Het
Gm14548	A	G	7: 3,894,548	I516T	possibly damaging	Het
Gm3250	T	A	10: 77,782,098	T149S	unknown	Het
Grip1	T	A	10: 120,035,451	D694E	probably damaging	Het
Heatr1	T	C	13: 12,413,352	V790A	probably benign	Het
Ighv1-54	G	A	12: 115,193,880	T49I	probably benign	Het
Iglv1	A	G	16: 19,085,303	V22A	probably benign	Het
Lama1	A	T	17: 67,753,843	Y722F		Het
Laptm5	A	T	4: 130,928,644	E91V		Het
Lrig1	A	G	6: 94,608,707		probably null	Het
Mcph1	T	G	8: 18,632,427	S527A	probably benign	Het
Med13l	G	T	5: 118,742,751	V1303L	probably benign	Het
Mindy4	A	G	6: 55,318,298	D741G	probably benign	Het
Myo15b	T	A	11: 115,892,352	*3034R	probably null	Het
Nfkbie	A	T	17: 45,562,033	K354I	probably damaging	Het
Npat	A	G	9: 53,563,476	N856S	possibly damaging	Het
Nr2c2ap	A	G	8: 70,133,158	D122G	probably damaging	Het
Nr4a3	C	A	4: 48,067,694	T430K	possibly damaging	Het
Olfr1145	C	A	2: 87,810,072	S84Y	probably damaging	Het
Olfr193	A	G	16: 59,110,002	S203P	probably benign	Het
Olfr599	T	G	7: 103,338,696	I214R	probably damaging	Het
Otud7b	A	G	3: 96,152,578	K397E	probably benign	Het
Pafah1b3	G	T	7: 25,297,473		probably benign	Het
Pcdhgc3	G	T	18: 37,807,616	V357L	probably damaging	Het
Pde2a	A	G	7: 101,503,291	T354A	unknown	Het
Rbfa	T	C	18: 80,192,811	H241R	probably damaging	Het
Rhox3c	C	T	X: 37,469,650		probably benign	Het
Rps6ka1	C	T	4: 133,872,839		probably benign	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Sbno1	A	G	5: 124,405,657	V273A	probably benign	Het
Scg3	T	C	9: 75,663,240	N344S	probably damaging	Het
Serpinb1c	C	G	13: 32,882,044	G306A	probably benign	Het
Sh2d6	C	T	6: 72,515,621	G206D	probably benign	Het
Slamf9	G	A	1: 172,477,371	S184N	probably damaging	Het
Slc50a1	T	C	3: 89,268,735	T168A	probably damaging	Het
Tas2r124	G	C	6: 132,755,071	W114C	probably damaging	Het
Tgm4	C	T	9: 123,048,551	T206I	possibly damaging	Het
Tmem52	A	G	4: 155,469,442		probably null	Het
Vmn2r102	A	G	17: 19,660,579	K61E	probably benign	Het
Vmn2r58	T	C	7: 41,837,663	I603V	probably benign	Het
Vstm2l	G	T	2: 157,914,875	G22V	unknown	Het
Vwa5b1	T	A	4: 138,588,679	Y584F	probably damaging	Het
Wdfy3	A	T	5: 101,847,174	V3233D	probably damaging	Het
Wdhd1	A	G	14: 47,273,952	V101A	probably benign	Het
Zfc3h1	C	A	10: 115,427,414	Q1761K	possibly damaging	Het
Zfp180	G	A	7: 24,104,890	V245I	probably benign	Het
Zfp846	A	T	9: 20,593,893	I350L	probably benign	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- AGATGACAGCGCTACAGAGC -3'
(R):5'- AAGTCCATGAAATGTGGGTCTG -3'

Sequencing Primer
(F):5'- GCTACAGAGCCAGCTCCAG -3'
(R):5'- GGTGTGGTCAAAGAAAAATTTGTCC -3'

Posted On

2021-11-19