Incidental Mutation 'R9045:Golga3'
ID 687975
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgin A3
Synonyms G1-499-14, repro27, Mea-2, Mea2, 5430416E01Rik
MMRRC Submission 068872-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9045 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110324723-110374336 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110340963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 552 (M552I)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: M592I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: M592I

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: M552I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: M552I

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A C 8: 33,919,362 (GRCm39) M61L Het
9130401M01Rik G T 15: 57,892,130 (GRCm39) A223E possibly damaging Het
Adgra1 T G 7: 139,432,566 (GRCm39) L135V possibly damaging Het
Aida A G 1: 183,094,940 (GRCm39) E127G possibly damaging Het
Ankrd31 T A 13: 96,968,034 (GRCm39) L557* probably null Het
Atxn7l3 T A 11: 102,183,272 (GRCm39) T221S probably damaging Het
Bbs7 A G 3: 36,666,184 (GRCm39) S27P probably benign Het
Cela3b A T 4: 137,152,110 (GRCm39) C116S possibly damaging Het
Clstn3 A C 6: 124,408,921 (GRCm39) M909R probably damaging Het
Cnot2 T C 10: 116,322,160 (GRCm39) E523G probably benign Het
Col12a1 T A 9: 79,582,034 (GRCm39) T1406S probably benign Het
Cr2 A T 1: 194,837,680 (GRCm39) N763K possibly damaging Het
Csmd1 A G 8: 16,284,088 (GRCm39) F557L probably damaging Het
Cyth1 T C 11: 118,073,090 (GRCm39) H270R possibly damaging Het
Epg5 T C 18: 77,992,014 (GRCm39) L237P probably damaging Het
Fbxo36 G A 1: 84,874,300 (GRCm39) D99N probably damaging Het
Fcgbpl1 T A 7: 27,853,856 (GRCm39) C1607S probably damaging Het
Flot2 A G 11: 77,950,023 (GRCm39) I417M probably benign Het
Fryl A G 5: 73,182,118 (GRCm39) L143P Het
Gckr A G 5: 31,457,353 (GRCm39) N122S possibly damaging Het
Gm3250 T A 10: 77,617,932 (GRCm39) T149S unknown Het
Grip1 T A 10: 119,871,356 (GRCm39) D694E probably damaging Het
Heatr1 T C 13: 12,428,233 (GRCm39) V790A probably benign Het
Ighv1-54 G A 12: 115,157,500 (GRCm39) T49I probably benign Het
Iglv1 A G 16: 18,904,053 (GRCm39) V22A probably benign Het
Lama1 A T 17: 68,060,838 (GRCm39) Y722F Het
Laptm5 A T 4: 130,655,955 (GRCm39) E91V Het
Lrig1 A G 6: 94,585,688 (GRCm39) probably null Het
Mcph1 T G 8: 18,682,443 (GRCm39) S527A probably benign Het
Med13l G T 5: 118,880,816 (GRCm39) V1303L probably benign Het
Mindy4 A G 6: 55,295,283 (GRCm39) D741G probably benign Het
Myo15b T A 11: 115,783,178 (GRCm39) *3034R probably null Het
Nfkbie A T 17: 45,872,959 (GRCm39) K354I probably damaging Het
Npat A G 9: 53,474,776 (GRCm39) N856S possibly damaging Het
Nr2c2ap A G 8: 70,585,808 (GRCm39) D122G probably damaging Het
Nr4a3 C A 4: 48,067,694 (GRCm39) T430K possibly damaging Het
Or12e10 C A 2: 87,640,416 (GRCm39) S84Y probably damaging Het
Or52ab4 T G 7: 102,987,903 (GRCm39) I214R probably damaging Het
Or5h25 A G 16: 58,930,365 (GRCm39) S203P probably benign Het
Otud7b A G 3: 96,059,895 (GRCm39) K397E probably benign Het
Pafah1b3 G T 7: 24,996,898 (GRCm39) probably benign Het
Pcdhgc3 G T 18: 37,940,669 (GRCm39) V357L probably damaging Het
Pde2a A G 7: 101,152,498 (GRCm39) T354A unknown Het
Pira12 A G 7: 3,897,547 (GRCm39) I516T possibly damaging Het
Rbfa T C 18: 80,236,026 (GRCm39) H241R probably damaging Het
Rhox3c C T X: 36,651,303 (GRCm39) probably benign Het
Rps6ka1 C T 4: 133,600,150 (GRCm39) probably benign Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Sbno1 A G 5: 124,543,720 (GRCm39) V273A probably benign Het
Scg3 T C 9: 75,570,522 (GRCm39) N344S probably damaging Het
Serpinb1c C G 13: 33,066,027 (GRCm39) G306A probably benign Het
Sh2d6 C T 6: 72,492,604 (GRCm39) G206D probably benign Het
Slamf9 G A 1: 172,304,938 (GRCm39) S184N probably damaging Het
Slc50a1 T C 3: 89,176,042 (GRCm39) T168A probably damaging Het
Tas2r124 G C 6: 132,732,034 (GRCm39) W114C probably damaging Het
Tgm4 C T 9: 122,877,616 (GRCm39) T206I possibly damaging Het
Tmem52 A G 4: 155,553,899 (GRCm39) probably null Het
Vmn2r102 A G 17: 19,880,841 (GRCm39) K61E probably benign Het
Vmn2r58 T C 7: 41,487,087 (GRCm39) I603V probably benign Het
Vstm2l G T 2: 157,756,795 (GRCm39) G22V unknown Het
Vwa5b1 T A 4: 138,315,990 (GRCm39) Y584F probably damaging Het
Wdfy3 A T 5: 101,995,040 (GRCm39) V3233D probably damaging Het
Wdhd1 A G 14: 47,511,409 (GRCm39) V101A probably benign Het
Zfc3h1 C A 10: 115,263,319 (GRCm39) Q1761K possibly damaging Het
Zfp180 G A 7: 23,804,315 (GRCm39) V245I probably benign Het
Zfp846 A T 9: 20,505,189 (GRCm39) I350L probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110,368,753 (GRCm39) missense probably damaging 1.00
IGL00594:Golga3 APN 5 110,352,841 (GRCm39) missense probably benign 0.37
IGL00672:Golga3 APN 5 110,360,110 (GRCm39) missense probably damaging 1.00
IGL00821:Golga3 APN 5 110,352,799 (GRCm39) missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110,335,583 (GRCm39) missense probably benign 0.04
IGL01408:Golga3 APN 5 110,365,675 (GRCm39) critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110,340,771 (GRCm39) critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110,336,612 (GRCm39) missense probably benign 0.26
cles UTSW 5 110,336,573 (GRCm39) nonsense probably null
tenta UTSW 5 110,365,996 (GRCm39) nonsense probably null
PIT4544001:Golga3 UTSW 5 110,336,556 (GRCm39) missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110,350,643 (GRCm39) missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110,350,643 (GRCm39) missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110,336,609 (GRCm39) missense probably damaging 1.00
R1219:Golga3 UTSW 5 110,332,215 (GRCm39) nonsense probably null
R1297:Golga3 UTSW 5 110,352,709 (GRCm39) missense probably benign 0.04
R1299:Golga3 UTSW 5 110,352,709 (GRCm39) missense probably benign 0.04
R1465:Golga3 UTSW 5 110,357,744 (GRCm39) missense probably damaging 1.00
R1465:Golga3 UTSW 5 110,357,744 (GRCm39) missense probably damaging 1.00
R1589:Golga3 UTSW 5 110,329,649 (GRCm39) missense probably damaging 1.00
R1795:Golga3 UTSW 5 110,355,493 (GRCm39) missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110,340,839 (GRCm39) missense probably damaging 0.96
R2116:Golga3 UTSW 5 110,335,261 (GRCm39) missense probably damaging 0.97
R2130:Golga3 UTSW 5 110,350,805 (GRCm39) critical splice donor site probably null
R2153:Golga3 UTSW 5 110,335,856 (GRCm39) splice site probably null
R2158:Golga3 UTSW 5 110,335,227 (GRCm39) missense probably damaging 1.00
R2357:Golga3 UTSW 5 110,350,514 (GRCm39) missense probably damaging 1.00
R2397:Golga3 UTSW 5 110,353,743 (GRCm39) splice site probably benign
R2418:Golga3 UTSW 5 110,349,734 (GRCm39) missense probably damaging 1.00
R2495:Golga3 UTSW 5 110,355,462 (GRCm39) missense probably damaging 0.99
R2763:Golga3 UTSW 5 110,352,761 (GRCm39) missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110,349,864 (GRCm39) splice site probably benign
R3614:Golga3 UTSW 5 110,368,774 (GRCm39) missense probably damaging 1.00
R4520:Golga3 UTSW 5 110,351,617 (GRCm39) nonsense probably null
R5001:Golga3 UTSW 5 110,353,643 (GRCm39) missense probably damaging 1.00
R5046:Golga3 UTSW 5 110,340,806 (GRCm39) missense probably damaging 0.99
R5157:Golga3 UTSW 5 110,350,537 (GRCm39) missense probably benign 0.00
R5191:Golga3 UTSW 5 110,332,173 (GRCm39) intron probably benign
R5376:Golga3 UTSW 5 110,368,811 (GRCm39) critical splice donor site probably null
R5399:Golga3 UTSW 5 110,352,890 (GRCm39) missense probably damaging 0.96
R5407:Golga3 UTSW 5 110,349,856 (GRCm39) nonsense probably null
R5884:Golga3 UTSW 5 110,364,761 (GRCm39) missense probably damaging 1.00
R6087:Golga3 UTSW 5 110,352,812 (GRCm39) missense probably damaging 0.99
R6526:Golga3 UTSW 5 110,352,761 (GRCm39) missense probably damaging 0.98
R6651:Golga3 UTSW 5 110,365,996 (GRCm39) nonsense probably null
R7041:Golga3 UTSW 5 110,356,450 (GRCm39) critical splice donor site probably null
R7057:Golga3 UTSW 5 110,336,529 (GRCm39) missense probably damaging 1.00
R7078:Golga3 UTSW 5 110,340,953 (GRCm39) missense probably damaging 0.99
R7114:Golga3 UTSW 5 110,350,578 (GRCm39) missense probably benign 0.01
R7190:Golga3 UTSW 5 110,357,721 (GRCm39) missense probably damaging 1.00
R7405:Golga3 UTSW 5 110,356,312 (GRCm39) missense probably damaging 0.97
R7528:Golga3 UTSW 5 110,360,098 (GRCm39) missense probably damaging 1.00
R7638:Golga3 UTSW 5 110,353,694 (GRCm39) missense probably benign
R7760:Golga3 UTSW 5 110,353,716 (GRCm39) missense probably benign 0.39
R8099:Golga3 UTSW 5 110,336,573 (GRCm39) nonsense probably null
R8144:Golga3 UTSW 5 110,333,745 (GRCm39) missense probably damaging 0.99
R8558:Golga3 UTSW 5 110,356,421 (GRCm39) missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110,350,721 (GRCm39) missense probably benign 0.05
R8887:Golga3 UTSW 5 110,353,626 (GRCm39) intron probably benign
R9039:Golga3 UTSW 5 110,352,799 (GRCm39) missense probably benign 0.00
R9057:Golga3 UTSW 5 110,332,465 (GRCm39) missense probably damaging 1.00
R9100:Golga3 UTSW 5 110,337,544 (GRCm39) missense probably benign 0.31
R9112:Golga3 UTSW 5 110,333,757 (GRCm39) missense probably benign 0.08
R9198:Golga3 UTSW 5 110,355,619 (GRCm39) missense probably benign 0.11
R9755:Golga3 UTSW 5 110,340,847 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGATGACAGCGCTACAGAGC -3'
(R):5'- AAGTCCATGAAATGTGGGTCTG -3'

Sequencing Primer
(F):5'- GCTACAGAGCCAGCTCCAG -3'
(R):5'- GGTGTGGTCAAAGAAAAATTTGTCC -3'
Posted On 2021-11-19