Incidental Mutation 'R9045:Iglv1'
ID 688013
Institutional Source Beutler Lab
Gene Symbol Iglv1
Ensembl Gene ENSMUSG00000076934
Gene Name immunoglobulin lambda variable 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R9045 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 19085017-19085460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19085303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000100462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103746]
AlphaFold A0A075B663
Predicted Effect probably benign
Transcript: ENSMUST00000103746
AA Change: V22A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100462
Gene: ENSMUSG00000076934
AA Change: V22A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 111 1.01e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A C 8: 33,429,334 M61L Het
9130401M01Rik G T 15: 58,028,734 A223E possibly damaging Het
9530053A07Rik T A 7: 28,154,431 C1607S probably damaging Het
Adgra1 T G 7: 139,852,650 L135V possibly damaging Het
Aida A G 1: 183,314,005 E127G possibly damaging Het
Ankrd31 T A 13: 96,831,526 L557* probably null Het
Atxn7l3 T A 11: 102,292,446 T221S probably damaging Het
Bbs7 A G 3: 36,612,035 S27P probably benign Het
Cela3b A T 4: 137,424,799 C116S possibly damaging Het
Clstn3 A C 6: 124,431,962 M909R probably damaging Het
Cnot2 T C 10: 116,486,255 E523G probably benign Het
Col12a1 T A 9: 79,674,752 T1406S probably benign Het
Cr2 A T 1: 195,155,372 N763K possibly damaging Het
Csmd1 A G 8: 16,234,074 F557L probably damaging Het
Cyth1 T C 11: 118,182,264 H270R possibly damaging Het
Epg5 T C 18: 77,948,799 L237P probably damaging Het
Fbxo36 G A 1: 84,896,579 D99N probably damaging Het
Flot2 A G 11: 78,059,197 I417M probably benign Het
Fryl A G 5: 73,024,775 L143P Het
Gckr A G 5: 31,300,009 N122S possibly damaging Het
Gm14548 A G 7: 3,894,548 I516T possibly damaging Het
Gm3250 T A 10: 77,782,098 T149S unknown Het
Golga3 G A 5: 110,193,097 M552I probably benign Het
Grip1 T A 10: 120,035,451 D694E probably damaging Het
Heatr1 T C 13: 12,413,352 V790A probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Ighv1-54 G A 12: 115,193,880 T49I probably benign Het
Lama1 A T 17: 67,753,843 Y722F Het
Laptm5 A T 4: 130,928,644 E91V Het
Lrig1 A G 6: 94,608,707 probably null Het
Mcph1 T G 8: 18,632,427 S527A probably benign Het
Med13l G T 5: 118,742,751 V1303L probably benign Het
Mindy4 A G 6: 55,318,298 D741G probably benign Het
Nfkbie A T 17: 45,562,033 K354I probably damaging Het
Npat A G 9: 53,563,476 N856S possibly damaging Het
Nr2c2ap A G 8: 70,133,158 D122G probably damaging Het
Nr4a3 C A 4: 48,067,694 T430K possibly damaging Het
Olfr1145 C A 2: 87,810,072 S84Y probably damaging Het
Olfr193 A G 16: 59,110,002 S203P probably benign Het
Olfr599 T G 7: 103,338,696 I214R probably damaging Het
Otud7b A G 3: 96,152,578 K397E probably benign Het
Pcdhgc3 G T 18: 37,807,616 V357L probably damaging Het
Pde2a A G 7: 101,503,291 T354A unknown Het
Rbfa T C 18: 80,192,811 H241R probably damaging Het
Rhox3c C T X: 37,469,650 probably benign Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sbno1 A G 5: 124,405,657 V273A probably benign Het
Scg3 T C 9: 75,663,240 N344S probably damaging Het
Serpinb1c C G 13: 32,882,044 G306A probably benign Het
Sh2d6 C T 6: 72,515,621 G206D probably benign Het
Slamf9 G A 1: 172,477,371 S184N probably damaging Het
Slc50a1 T C 3: 89,268,735 T168A probably damaging Het
Tas2r124 G C 6: 132,755,071 W114C probably damaging Het
Tgm4 C T 9: 123,048,551 T206I possibly damaging Het
Tmem52 A G 4: 155,469,442 probably null Het
Vmn2r102 A G 17: 19,660,579 K61E probably benign Het
Vmn2r58 T C 7: 41,837,663 I603V probably benign Het
Vstm2l G T 2: 157,914,875 G22V unknown Het
Vwa5b1 T A 4: 138,588,679 Y584F probably damaging Het
Wdfy3 A T 5: 101,847,174 V3233D probably damaging Het
Wdhd1 A G 14: 47,273,952 V101A probably benign Het
Zfc3h1 C A 10: 115,427,414 Q1761K possibly damaging Het
Zfp180 G A 7: 24,104,890 V245I probably benign Het
Zfp846 A T 9: 20,593,893 I350L probably benign Het
Other mutations in Iglv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Iglv1 APN 16 19085223 missense possibly damaging 0.91
R5764:Iglv1 UTSW 16 19085440 missense unknown
R6175:Iglv1 UTSW 16 19085094 missense probably damaging 1.00
R7763:Iglv1 UTSW 16 19085489 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAATCTGGCAGGAACACC -3'
(R):5'- ATGTCTGTCTCACAGCCTGC -3'

Sequencing Primer
(F):5'- AACACCTGGAGCTCGGTTG -3'
(R):5'- CCTGCTGCTGACCAATATTGAAAAG -3'
Posted On 2021-11-19