Incidental Mutation 'R9046:Ptprt'
ID 688032
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9046 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 161372361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1437 (T1437M)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000109441
AA Change: T1437M

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: T1437M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109442
AA Change: T1436M

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: T1436M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: T1427M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: T1427M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: T1417M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: T1417M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,243,525 (GRCm39) V1796A probably benign Het
Abca3 A G 17: 24,617,477 (GRCm39) D1058G probably damaging Het
Adgrg6 A G 10: 14,323,858 (GRCm39) V431A probably benign Het
Amdhd1 C T 10: 93,363,087 (GRCm39) D334N probably damaging Het
Ankrd50 A T 3: 38,506,642 (GRCm39) M252K probably benign Het
Anxa3 G A 5: 96,976,626 (GRCm39) R204Q probably damaging Het
Apmap T C 2: 150,426,093 (GRCm39) T352A probably benign Het
Arhgef4 A G 1: 34,850,846 (GRCm39) E464G possibly damaging Het
Atp11b T A 3: 35,852,740 (GRCm39) probably benign Het
Brwd1 T A 16: 95,829,402 (GRCm39) S1100C probably damaging Het
Ccm2l T A 2: 152,916,720 (GRCm39) I317N probably damaging Het
Ccr9 C T 9: 123,608,831 (GRCm39) T171I probably benign Het
Cdh23 A T 10: 60,218,303 (GRCm39) probably benign Het
Dact1 A G 12: 71,365,534 (GRCm39) I735V probably benign Het
Dok6 C A 18: 89,787,221 (GRCm39) V14L probably benign Het
Dthd1 A T 5: 62,984,603 (GRCm39) Y436F possibly damaging Het
Fndc9 G T 11: 46,128,889 (GRCm39) W136L probably damaging Het
Gal3st1 G A 11: 3,948,278 (GRCm39) V162I probably benign Het
Gart A G 16: 91,418,561 (GRCm39) S973P probably damaging Het
H2-T5 A T 17: 36,476,035 (GRCm39) probably null Het
Hsp90ab1 G A 17: 45,879,969 (GRCm39) P516S probably damaging Het
Htr1a G C 13: 105,581,816 (GRCm39) G352A probably damaging Het
Hycc2 T C 1: 58,568,945 (GRCm39) T545A probably damaging Het
Isg20 A T 7: 78,569,823 (GRCm39) R265* probably null Het
Kcmf1 C T 6: 72,825,455 (GRCm39) A213T probably damaging Het
Kdm3a A G 6: 71,572,540 (GRCm39) V1007A probably damaging Het
Klhl25 A G 7: 75,515,337 (GRCm39) E81G probably damaging Het
Klhl6 C A 16: 19,765,803 (GRCm39) V600F probably damaging Het
Kmt2b A G 7: 30,285,479 (GRCm39) V471A probably benign Het
Lap3 A G 5: 45,652,562 (GRCm39) T53A probably damaging Het
Lmntd1 A T 6: 145,365,565 (GRCm39) I188N probably damaging Het
Lrba A G 3: 86,302,543 (GRCm39) I1868V possibly damaging Het
Mef2d A T 3: 88,074,825 (GRCm39) Y337F probably benign Het
Mgat4e T C 1: 134,474,742 (GRCm39) T7A possibly damaging Het
Myo3a G T 2: 22,448,367 (GRCm39) L985F probably damaging Het
Myof T C 19: 37,923,112 (GRCm39) probably benign Het
Ncapg2 G A 12: 116,376,145 (GRCm39) G77S probably benign Het
Nostrin G T 2: 68,975,123 (GRCm39) V13L probably benign Het
Nup155 TGGG TGG 15: 8,157,919 (GRCm39) probably null Het
Or14j6 A G 17: 38,215,145 (GRCm39) K236R probably damaging Het
Or3a10 T C 11: 73,935,284 (GRCm39) D272G probably damaging Het
Or4a75 C T 2: 89,448,496 (GRCm39) probably benign Het
Or5b101 T C 19: 13,005,115 (GRCm39) N193D probably benign Het
Parp4 A C 14: 56,864,927 (GRCm39) K1025T probably damaging Het
Parvb T C 15: 84,174,639 (GRCm39) I144T probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phf10 A G 17: 15,175,160 (GRCm39) V195A probably damaging Het
Prpf18 A T 2: 4,640,464 (GRCm39) M257K possibly damaging Het
Ptcd3 A T 6: 71,870,364 (GRCm39) probably null Het
Ptx3 T C 3: 66,132,153 (GRCm39) F225L probably damaging Het
Rpl3l A G 17: 24,947,435 (GRCm39) K50E probably damaging Het
Rubcn T C 16: 32,661,940 (GRCm39) N427D probably benign Het
Serpinb8 G A 1: 107,530,563 (GRCm39) A114T possibly damaging Het
Sgsm1 A G 5: 113,436,725 (GRCm39) V35A probably damaging Het
Slc22a2 G A 17: 12,834,234 (GRCm39) A501T probably null Het
Slu7 G A 11: 43,335,629 (GRCm39) C455Y probably damaging Het
Src C A 2: 157,307,795 (GRCm39) H235N probably damaging Het
Svopl T A 6: 37,998,531 (GRCm39) M248L probably benign Het
Tbx6 G A 7: 126,381,120 (GRCm39) probably null Het
Tprg1l A T 4: 154,242,913 (GRCm39) I239N probably damaging Het
Trafd1 A G 5: 121,513,189 (GRCm39) F350L probably benign Het
Trpv3 A G 11: 73,176,698 (GRCm39) Y359C probably damaging Het
Vmn1r46 T C 6: 89,953,585 (GRCm39) S145P probably damaging Het
Vmn2r11 A T 5: 109,202,850 (GRCm39) F76I probably benign Het
Xpot A T 10: 121,432,149 (GRCm39) C916* probably null Het
Zfp236 C T 18: 82,637,042 (GRCm39) E1415K possibly damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGCCCTGCAGGAAAGAG -3'
(R):5'- GCTCAGACTAAAGTTCGAATGG -3'

Sequencing Primer
(F):5'- TTGCCCTGCAGGAAAGAGAAATTG -3'
(R):5'- ACTAGGTCTGCTAGGACAGGTACTC -3'
Posted On 2021-11-19