Incidental Mutation 'R9046:Sgsm1'
ID 688042
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9046 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113288859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: V35A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112325
AA Change: V35A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154248
AA Change: V35A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,525 V1796A probably benign Het
Abca3 A G 17: 24,398,503 D1058G probably damaging Het
Adgrg6 A G 10: 14,448,114 V431A probably benign Het
Amdhd1 C T 10: 93,527,225 D334N probably damaging Het
Ankrd50 A T 3: 38,452,493 M252K probably benign Het
Anxa3 G A 5: 96,828,767 R204Q probably damaging Het
Apmap T C 2: 150,584,173 T352A probably benign Het
Arhgef4 A G 1: 34,811,765 E464G possibly damaging Het
Brwd1 T A 16: 96,028,202 S1100C probably damaging Het
Ccm2l T A 2: 153,074,800 I317N probably damaging Het
Ccr9 C T 9: 123,779,766 T171I probably benign Het
Dact1 A G 12: 71,318,760 I735V probably benign Het
Dok6 C A 18: 89,769,097 V14L probably benign Het
Dthd1 A T 5: 62,827,260 Y436F possibly damaging Het
Fam126b T C 1: 58,529,786 T545A probably damaging Het
Fndc9 G T 11: 46,238,062 W136L probably damaging Het
Gal3st1 G A 11: 3,998,278 V162I probably benign Het
Gart A G 16: 91,621,673 S973P probably damaging Het
Gm8909 A T 17: 36,165,143 probably null Het
Hsp90ab1 G A 17: 45,569,043 P516S probably damaging Het
Htr1a G C 13: 105,445,308 G352A probably damaging Het
Isg20 A T 7: 78,920,075 R265* probably null Het
Kcmf1 C T 6: 72,848,472 A213T probably damaging Het
Kdm3a A G 6: 71,595,556 V1007A probably damaging Het
Klhl25 A G 7: 75,865,589 E81G probably damaging Het
Klhl6 C A 16: 19,947,053 V600F probably damaging Het
Kmt2b A G 7: 30,586,054 V471A probably benign Het
Lap3 A G 5: 45,495,220 T53A probably damaging Het
Lmntd1 A T 6: 145,419,839 I188N probably damaging Het
Lrba A G 3: 86,395,236 I1868V possibly damaging Het
Mef2d A T 3: 88,167,518 Y337F probably benign Het
Mgat4e T C 1: 134,547,004 T7A possibly damaging Het
Myo3a G T 2: 22,558,355 L985F probably damaging Het
Ncapg2 G A 12: 116,412,525 G77S probably benign Het
Nostrin G T 2: 69,144,779 V13L probably benign Het
Nup155 TGGG TGG 15: 8,128,435 probably null Het
Olfr127 A G 17: 37,904,254 K236R probably damaging Het
Olfr139 T C 11: 74,044,458 D272G probably damaging Het
Olfr1453 T C 19: 13,027,751 N193D probably benign Het
Parp4 A C 14: 56,627,470 K1025T probably damaging Het
Parvb T C 15: 84,290,438 I144T probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phf10 A G 17: 14,954,898 V195A probably damaging Het
Prpf18 A T 2: 4,635,653 M257K possibly damaging Het
Ptcd3 A T 6: 71,893,380 probably null Het
Ptprt G A 2: 161,530,441 T1437M possibly damaging Het
Ptx3 T C 3: 66,224,732 F225L probably damaging Het
Rpl3l A G 17: 24,728,461 K50E probably damaging Het
Rubcn T C 16: 32,841,570 N427D probably benign Het
Serpinb8 G A 1: 107,602,833 A114T possibly damaging Het
Slc22a2 G A 17: 12,615,347 A501T probably null Het
Slu7 G A 11: 43,444,802 C455Y probably damaging Het
Src C A 2: 157,465,875 H235N probably damaging Het
Svopl T A 6: 38,021,596 M248L probably benign Het
Tbx6 G A 7: 126,781,948 probably null Het
Tprgl A T 4: 154,158,456 I239N probably damaging Het
Trafd1 A G 5: 121,375,126 F350L probably benign Het
Trpv3 A G 11: 73,285,872 Y359C probably damaging Het
Vmn1r46 T C 6: 89,976,603 S145P probably damaging Het
Vmn2r11 A T 5: 109,054,984 F76I probably benign Het
Xpot A T 10: 121,596,244 C916* probably null Het
Zfp236 C T 18: 82,618,917 E1415K possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCCCGAAATAACTCCAG -3'
(R):5'- TCTGGAAGAGGTGACAGACC -3'

Sequencing Primer
(F):5'- CAGAGTCACAAAGCCCGGTG -3'
(R):5'- TCTACTTCAGACCAAGAGGCTGTAG -3'
Posted On 2021-11-19