Incidental Mutation 'R9046:Sgsm1'
ID 688042
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, D5Bwg1524e, 2410098H20Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9046 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113391086-113458652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113436725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: V35A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112325
AA Change: V35A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154248
AA Change: V35A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: V35A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,243,525 (GRCm39) V1796A probably benign Het
Abca3 A G 17: 24,617,477 (GRCm39) D1058G probably damaging Het
Adgrg6 A G 10: 14,323,858 (GRCm39) V431A probably benign Het
Amdhd1 C T 10: 93,363,087 (GRCm39) D334N probably damaging Het
Ankrd50 A T 3: 38,506,642 (GRCm39) M252K probably benign Het
Anxa3 G A 5: 96,976,626 (GRCm39) R204Q probably damaging Het
Apmap T C 2: 150,426,093 (GRCm39) T352A probably benign Het
Arhgef4 A G 1: 34,850,846 (GRCm39) E464G possibly damaging Het
Atp11b T A 3: 35,852,740 (GRCm39) probably benign Het
Brwd1 T A 16: 95,829,402 (GRCm39) S1100C probably damaging Het
Ccm2l T A 2: 152,916,720 (GRCm39) I317N probably damaging Het
Ccr9 C T 9: 123,608,831 (GRCm39) T171I probably benign Het
Cdh23 A T 10: 60,218,303 (GRCm39) probably benign Het
Dact1 A G 12: 71,365,534 (GRCm39) I735V probably benign Het
Dok6 C A 18: 89,787,221 (GRCm39) V14L probably benign Het
Dthd1 A T 5: 62,984,603 (GRCm39) Y436F possibly damaging Het
Fndc9 G T 11: 46,128,889 (GRCm39) W136L probably damaging Het
Gal3st1 G A 11: 3,948,278 (GRCm39) V162I probably benign Het
Gart A G 16: 91,418,561 (GRCm39) S973P probably damaging Het
H2-T5 A T 17: 36,476,035 (GRCm39) probably null Het
Hsp90ab1 G A 17: 45,879,969 (GRCm39) P516S probably damaging Het
Htr1a G C 13: 105,581,816 (GRCm39) G352A probably damaging Het
Hycc2 T C 1: 58,568,945 (GRCm39) T545A probably damaging Het
Isg20 A T 7: 78,569,823 (GRCm39) R265* probably null Het
Kcmf1 C T 6: 72,825,455 (GRCm39) A213T probably damaging Het
Kdm3a A G 6: 71,572,540 (GRCm39) V1007A probably damaging Het
Klhl25 A G 7: 75,515,337 (GRCm39) E81G probably damaging Het
Klhl6 C A 16: 19,765,803 (GRCm39) V600F probably damaging Het
Kmt2b A G 7: 30,285,479 (GRCm39) V471A probably benign Het
Lap3 A G 5: 45,652,562 (GRCm39) T53A probably damaging Het
Lmntd1 A T 6: 145,365,565 (GRCm39) I188N probably damaging Het
Lrba A G 3: 86,302,543 (GRCm39) I1868V possibly damaging Het
Mef2d A T 3: 88,074,825 (GRCm39) Y337F probably benign Het
Mgat4e T C 1: 134,474,742 (GRCm39) T7A possibly damaging Het
Myo3a G T 2: 22,448,367 (GRCm39) L985F probably damaging Het
Myof T C 19: 37,923,112 (GRCm39) probably benign Het
Ncapg2 G A 12: 116,376,145 (GRCm39) G77S probably benign Het
Nostrin G T 2: 68,975,123 (GRCm39) V13L probably benign Het
Nup155 TGGG TGG 15: 8,157,919 (GRCm39) probably null Het
Or14j6 A G 17: 38,215,145 (GRCm39) K236R probably damaging Het
Or3a10 T C 11: 73,935,284 (GRCm39) D272G probably damaging Het
Or4a75 C T 2: 89,448,496 (GRCm39) probably benign Het
Or5b101 T C 19: 13,005,115 (GRCm39) N193D probably benign Het
Parp4 A C 14: 56,864,927 (GRCm39) K1025T probably damaging Het
Parvb T C 15: 84,174,639 (GRCm39) I144T probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phf10 A G 17: 15,175,160 (GRCm39) V195A probably damaging Het
Prpf18 A T 2: 4,640,464 (GRCm39) M257K possibly damaging Het
Ptcd3 A T 6: 71,870,364 (GRCm39) probably null Het
Ptprt G A 2: 161,372,361 (GRCm39) T1437M possibly damaging Het
Ptx3 T C 3: 66,132,153 (GRCm39) F225L probably damaging Het
Rpl3l A G 17: 24,947,435 (GRCm39) K50E probably damaging Het
Rubcn T C 16: 32,661,940 (GRCm39) N427D probably benign Het
Serpinb8 G A 1: 107,530,563 (GRCm39) A114T possibly damaging Het
Slc22a2 G A 17: 12,834,234 (GRCm39) A501T probably null Het
Slu7 G A 11: 43,335,629 (GRCm39) C455Y probably damaging Het
Src C A 2: 157,307,795 (GRCm39) H235N probably damaging Het
Svopl T A 6: 37,998,531 (GRCm39) M248L probably benign Het
Tbx6 G A 7: 126,381,120 (GRCm39) probably null Het
Tprg1l A T 4: 154,242,913 (GRCm39) I239N probably damaging Het
Trafd1 A G 5: 121,513,189 (GRCm39) F350L probably benign Het
Trpv3 A G 11: 73,176,698 (GRCm39) Y359C probably damaging Het
Vmn1r46 T C 6: 89,953,585 (GRCm39) S145P probably damaging Het
Vmn2r11 A T 5: 109,202,850 (GRCm39) F76I probably benign Het
Xpot A T 10: 121,432,149 (GRCm39) C916* probably null Het
Zfp236 C T 18: 82,637,042 (GRCm39) E1415K possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113,392,930 (GRCm39) missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113,424,008 (GRCm39) missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113,424,048 (GRCm39) splice site probably benign
IGL01602:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113,411,356 (GRCm39) missense probably benign
IGL01920:Sgsm1 APN 5 113,421,471 (GRCm39) missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL02387:Sgsm1 APN 5 113,400,929 (GRCm39) missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL03177:Sgsm1 APN 5 113,398,859 (GRCm39) missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113,432,887 (GRCm39) missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113,403,182 (GRCm39) missense possibly damaging 0.67
caliente UTSW 5 113,428,328 (GRCm39) intron probably benign
Chili UTSW 5 113,405,989 (GRCm39) intron probably benign
pimiento UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113,416,616 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113,436,702 (GRCm39) missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113,427,136 (GRCm39) splice site probably benign
R0099:Sgsm1 UTSW 5 113,422,226 (GRCm39) splice site probably benign
R0269:Sgsm1 UTSW 5 113,434,795 (GRCm39) critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113,411,571 (GRCm39) missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113,436,701 (GRCm39) missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113,411,625 (GRCm39) missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113,458,428 (GRCm39) missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113,392,894 (GRCm39) missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113,432,989 (GRCm39) splice site probably benign
R0744:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113,406,708 (GRCm39) missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113,413,740 (GRCm39) missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113,427,351 (GRCm39) missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113,421,577 (GRCm39) nonsense probably null
R1473:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113,411,135 (GRCm39) missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113,421,483 (GRCm39) missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113,411,381 (GRCm39) missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113,433,266 (GRCm39) missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113,433,270 (GRCm39) missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113,405,989 (GRCm39) intron probably benign
R4558:Sgsm1 UTSW 5 113,405,977 (GRCm39) intron probably benign
R4610:Sgsm1 UTSW 5 113,403,173 (GRCm39) missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113,407,913 (GRCm39) critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113,430,492 (GRCm39) missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113,428,328 (GRCm39) intron probably benign
R4992:Sgsm1 UTSW 5 113,430,486 (GRCm39) missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113,398,905 (GRCm39) missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113,398,823 (GRCm39) missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113,398,822 (GRCm39) missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113,434,704 (GRCm39) missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113,430,522 (GRCm39) missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113,426,997 (GRCm39) critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113,428,246 (GRCm39) missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113,421,512 (GRCm39) missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113,416,712 (GRCm39) splice site probably null
R7387:Sgsm1 UTSW 5 113,411,566 (GRCm39) missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113,422,187 (GRCm39) missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113,427,501 (GRCm39) splice site probably null
R7624:Sgsm1 UTSW 5 113,422,201 (GRCm39) nonsense probably null
R7632:Sgsm1 UTSW 5 113,423,948 (GRCm39) missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113,400,890 (GRCm39) missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113,422,193 (GRCm39) missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113,414,196 (GRCm39) missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113,430,510 (GRCm39) missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113,403,134 (GRCm39) missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113,398,877 (GRCm39) missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113,407,958 (GRCm39) missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113,411,284 (GRCm39) missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113,435,097 (GRCm39) missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113,432,861 (GRCm39) missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113,430,577 (GRCm39) missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113,428,201 (GRCm39) missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113,422,139 (GRCm39) missense unknown
R9377:Sgsm1 UTSW 5 113,436,741 (GRCm39) missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113,423,898 (GRCm39) critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113,427,097 (GRCm39) missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113,428,207 (GRCm39) missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113,458,418 (GRCm39) missense probably benign
Z1177:Sgsm1 UTSW 5 113,430,576 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCCCGAAATAACTCCAG -3'
(R):5'- TCTGGAAGAGGTGACAGACC -3'

Sequencing Primer
(F):5'- CAGAGTCACAAAGCCCGGTG -3'
(R):5'- TCTACTTCAGACCAAGAGGCTGTAG -3'
Posted On 2021-11-19