Incidental Mutation 'R9046:Gal3st1'
ID 688059
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms GalCer sulfotransferase, Gcst, Cst, galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9046 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 3983636-3999326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3998278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 162 (V162I)
Ref Sequence ENSEMBL: ENSMUSP00000058348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect probably benign
Transcript: ENSMUST00000063004
AA Change: V162I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: V162I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078757
AA Change: V162I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: V162I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109981
AA Change: V162I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: V162I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,525 V1796A probably benign Het
Abca3 A G 17: 24,398,503 D1058G probably damaging Het
Adgrg6 A G 10: 14,448,114 V431A probably benign Het
Amdhd1 C T 10: 93,527,225 D334N probably damaging Het
Ankrd50 A T 3: 38,452,493 M252K probably benign Het
Anxa3 G A 5: 96,828,767 R204Q probably damaging Het
Apmap T C 2: 150,584,173 T352A probably benign Het
Arhgef4 A G 1: 34,811,765 E464G possibly damaging Het
Brwd1 T A 16: 96,028,202 S1100C probably damaging Het
Ccm2l T A 2: 153,074,800 I317N probably damaging Het
Ccr9 C T 9: 123,779,766 T171I probably benign Het
Dact1 A G 12: 71,318,760 I735V probably benign Het
Dok6 C A 18: 89,769,097 V14L probably benign Het
Dthd1 A T 5: 62,827,260 Y436F possibly damaging Het
Fam126b T C 1: 58,529,786 T545A probably damaging Het
Fndc9 G T 11: 46,238,062 W136L probably damaging Het
Gart A G 16: 91,621,673 S973P probably damaging Het
Gm8909 A T 17: 36,165,143 probably null Het
Hsp90ab1 G A 17: 45,569,043 P516S probably damaging Het
Htr1a G C 13: 105,445,308 G352A probably damaging Het
Isg20 A T 7: 78,920,075 R265* probably null Het
Kcmf1 C T 6: 72,848,472 A213T probably damaging Het
Kdm3a A G 6: 71,595,556 V1007A probably damaging Het
Klhl25 A G 7: 75,865,589 E81G probably damaging Het
Klhl6 C A 16: 19,947,053 V600F probably damaging Het
Kmt2b A G 7: 30,586,054 V471A probably benign Het
Lap3 A G 5: 45,495,220 T53A probably damaging Het
Lmntd1 A T 6: 145,419,839 I188N probably damaging Het
Lrba A G 3: 86,395,236 I1868V possibly damaging Het
Mef2d A T 3: 88,167,518 Y337F probably benign Het
Mgat4e T C 1: 134,547,004 T7A possibly damaging Het
Myo3a G T 2: 22,558,355 L985F probably damaging Het
Ncapg2 G A 12: 116,412,525 G77S probably benign Het
Nostrin G T 2: 69,144,779 V13L probably benign Het
Nup155 TGGG TGG 15: 8,128,435 probably null Het
Olfr127 A G 17: 37,904,254 K236R probably damaging Het
Olfr139 T C 11: 74,044,458 D272G probably damaging Het
Olfr1453 T C 19: 13,027,751 N193D probably benign Het
Parp4 A C 14: 56,627,470 K1025T probably damaging Het
Parvb T C 15: 84,290,438 I144T probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phf10 A G 17: 14,954,898 V195A probably damaging Het
Prpf18 A T 2: 4,635,653 M257K possibly damaging Het
Ptcd3 A T 6: 71,893,380 probably null Het
Ptprt G A 2: 161,530,441 T1437M possibly damaging Het
Ptx3 T C 3: 66,224,732 F225L probably damaging Het
Rpl3l A G 17: 24,728,461 K50E probably damaging Het
Rubcn T C 16: 32,841,570 N427D probably benign Het
Serpinb8 G A 1: 107,602,833 A114T possibly damaging Het
Sgsm1 A G 5: 113,288,859 V35A probably damaging Het
Slc22a2 G A 17: 12,615,347 A501T probably null Het
Slu7 G A 11: 43,444,802 C455Y probably damaging Het
Src C A 2: 157,465,875 H235N probably damaging Het
Svopl T A 6: 38,021,596 M248L probably benign Het
Tbx6 G A 7: 126,781,948 probably null Het
Tprgl A T 4: 154,158,456 I239N probably damaging Het
Trafd1 A G 5: 121,375,126 F350L probably benign Het
Trpv3 A G 11: 73,285,872 Y359C probably damaging Het
Vmn1r46 T C 6: 89,976,603 S145P probably damaging Het
Vmn2r11 A T 5: 109,054,984 F76I probably benign Het
Xpot A T 10: 121,596,244 C916* probably null Het
Zfp236 C T 18: 82,618,917 E1415K possibly damaging Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3999070 utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3996914 utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3998564 missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3998405 missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3998996 missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3998741 missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3998110 missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3998546 missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3998509 missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3998931 missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3998231 missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3998618 missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3998110 missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3998903 missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3999002 missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3998509 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998609 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998651 missense probably damaging 0.98
R7290:Gal3st1 UTSW 11 3998093 missense possibly damaging 0.70
R7438:Gal3st1 UTSW 11 3998227 missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3998405 missense probably damaging 1.00
R9475:Gal3st1 UTSW 11 3998660 missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3998153 missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3997984 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACACTGCTCAACATCCTG -3'
(R):5'- CGGGTCCAGGCTACTATCATAG -3'

Sequencing Primer
(F):5'- TTCGGCCAGAAGCACGAG -3'
(R):5'- GCTACTATCATAGCCCAGATCG -3'
Posted On 2021-11-19