Incidental Mutation 'R9047:Nyap2'
ID 688086
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Name neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Synonyms Jr6, 9430031J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 81076950-81341764 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81298088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 649 (R649H)
Ref Sequence ENSEMBL: ENSMUSP00000120767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000113494
AA Change: R649H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976
AA Change: R649H

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123285
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123720
AA Change: R681H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976
AA Change: R681H

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137862
AA Change: R649H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976
AA Change: R649H

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,939,093 S156T probably damaging Het
4930522L14Rik A G 5: 109,737,554 L146P Het
Adra1a T A 14: 66,638,185 M203K probably damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Akt3 G T 1: 177,059,389 T298K probably damaging Het
Aldh4a1 G T 4: 139,623,200 probably benign Het
Aplf T C 6: 87,663,797 T77A possibly damaging Het
Arid4b T A 13: 14,181,230 W618R probably damaging Het
Asxl3 C A 18: 22,452,408 P130Q probably damaging Het
Asxl3 A G 18: 22,452,414 K132R probably damaging Het
Atp11a T C 8: 12,828,483 M353T probably damaging Het
Atp11b A G 3: 35,806,889 D375G probably damaging Het
BC052040 A G 2: 115,777,023 T286A probably benign Het
Cage1 C T 13: 38,017,362 A656T possibly damaging Het
Casz1 C T 4: 148,939,040 P801S probably damaging Het
Ccdc130 C T 8: 84,263,898 R35Q probably damaging Het
Ccdc144b A G 3: 36,032,884 I187T probably benign Het
Cdc14b A T 13: 64,220,944 probably benign Het
Cox6b2 A G 7: 4,752,087 F63L probably benign Het
Cramp1l A C 17: 24,979,629 V773G possibly damaging Het
Cul7 A G 17: 46,654,522 E542G probably benign Het
Cyp2c55 T C 19: 39,031,346 Y243H possibly damaging Het
Dnah9 C A 11: 66,072,099 D1797Y possibly damaging Het
Dpep2 C A 8: 105,989,312 A298S Het
Dvl3 G A 16: 20,524,076 probably null Het
Enpp3 T C 10: 24,798,274 D376G possibly damaging Het
Ffar4 T C 19: 38,113,784 I289T possibly damaging Het
Gm3417 A G 17: 14,967,680 Y111H probably damaging Het
Gm5565 T C 5: 146,158,039 Y299C probably damaging Het
Gm8765 C T 13: 50,702,092 R589* probably null Het
Gpat3 A T 5: 100,846,922 M39L probably benign Het
Gpr153 T C 4: 152,280,207 L240P probably damaging Het
Gpr182 T C 10: 127,750,648 I145V probably benign Het
H2-Q4 A T 17: 35,379,993 T80S possibly damaging Het
Hnf1a T A 5: 114,950,823 T545S probably benign Het
Kif5b A C 18: 6,208,261 F946V probably benign Het
Krtap16-1 C T 11: 99,986,341 C79Y probably damaging Het
Lama2 A G 10: 27,006,701 V2622A possibly damaging Het
Lrrc37a T A 11: 103,500,549 Q1350L probably damaging Het
Map2k2 G A 10: 81,119,664 V294I probably benign Het
Mtus1 G A 8: 41,083,723 H319Y possibly damaging Het
Ncdn T C 4: 126,750,828 D67G possibly damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nlrp9b A G 7: 20,023,476 I213V possibly damaging Het
Olfr1165-ps T G 2: 88,101,072 D305A unknown Het
Olfr1200 C A 2: 88,767,955 R120L probably damaging Het
Olfr304 A G 7: 86,386,040 S207P probably benign Het
Pi4kb T A 3: 94,993,117 L354Q probably damaging Het
Plekhh2 T C 17: 84,590,762 S944P probably damaging Het
Podn C T 4: 108,021,546 V375M probably damaging Het
Pramef8 C A 4: 143,419,103 Q381K possibly damaging Het
Psmb2 T A 4: 126,706,102 H110Q probably benign Het
Rasip1 A G 7: 45,632,642 E523G possibly damaging Het
Ripor1 T G 8: 105,616,151 C219G probably damaging Het
Rps6ka2 G C 17: 7,300,279 V714L probably damaging Het
Sass6 G T 3: 116,613,998 L254F probably damaging Het
Scarf2 G A 16: 17,806,406 G525E probably damaging Het
Sh3d21 T A 4: 126,152,338 probably benign Het
Sh3tc1 C A 5: 35,706,483 A787S probably benign Het
Skint5 T A 4: 113,655,722 N871I unknown Het
Slc48a1 T G 15: 97,789,952 D62E probably damaging Het
Slc6a21 G A 7: 45,286,974 M157I Het
Slurp2 T C 15: 74,743,112 D60G probably benign Het
Sparcl1 G T 5: 104,093,113 N148K possibly damaging Het
Spsb2 T A 6: 124,810,013 N236K probably benign Het
Sptb G T 12: 76,632,534 probably benign Het
Ssc4d A T 5: 135,961,176 C41S probably damaging Het
Tecta A T 9: 42,375,079 D760E probably benign Het
Tesmin G T 19: 3,389,431 probably benign Het
Tiam1 A C 16: 89,804,888 probably benign Het
Tldc1 T C 8: 119,762,311 N411S probably benign Het
Tnrc6a T C 7: 123,179,723 L1219S probably damaging Het
Tram1 T G 1: 13,569,606 I306L probably benign Het
Trank1 A C 9: 111,362,432 D503A probably damaging Het
Ttc21b T C 2: 66,201,252 H1044R Het
Ubac2 T C 14: 121,908,214 F95L probably benign Het
Vmn2r91 A T 17: 18,106,034 M194L probably benign Het
Zdhhc1 G T 8: 105,478,901 H90Q probably damaging Het
Zfp169 C T 13: 48,498,816 V42I probably damaging Het
Zfp81 A G 17: 33,334,413 C476R probably damaging Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81192107 missense probably benign 0.03
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81241193 missense probably damaging 0.99
R4298:Nyap2 UTSW 1 81241096 missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81087274 start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
R7558:Nyap2 UTSW 1 81269373 missense probably benign 0.01
R8078:Nyap2 UTSW 1 81241057 missense possibly damaging 0.95
R8231:Nyap2 UTSW 1 81192131 missense probably benign
R8482:Nyap2 UTSW 1 81241637 missense probably damaging 1.00
R9056:Nyap2 UTSW 1 81336599 missense probably benign 0.15
R9193:Nyap2 UTSW 1 81297997 missense probably damaging 0.97
R9210:Nyap2 UTSW 1 81241327 missense probably damaging 1.00
R9260:Nyap2 UTSW 1 81087118 intron probably benign
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTCACGTGTCACCGAACAC -3'
(R):5'- CATGATTCGGTAACAAACAGCAAAG -3'

Sequencing Primer
(F):5'- GAGGCAGAGCTCTGGTCCAC -3'
(R):5'- GGTAACAAACAGCAAAGAAACTATC -3'
Posted On 2021-11-19