Incidental Mutation 'R9047:Ttc21b'
ID 688089
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Name tetratricopeptide repeat domain 21B
Synonyms line 158, Thm1, aln, 2410066K11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66184327-66256617 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66201252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1044 (H1044R)
Ref Sequence ENSEMBL: ENSMUSP00000099779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
AlphaFold Q0HA38
Predicted Effect
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: H1044R

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125446
AA Change: H1044R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: H1044R

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,939,093 S156T probably damaging Het
4930522L14Rik A G 5: 109,737,554 L146P Het
Adra1a T A 14: 66,638,185 M203K probably damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Akt3 G T 1: 177,059,389 T298K probably damaging Het
Aldh4a1 G T 4: 139,623,200 probably benign Het
Aplf T C 6: 87,663,797 T77A possibly damaging Het
Arid4b T A 13: 14,181,230 W618R probably damaging Het
Asxl3 C A 18: 22,452,408 P130Q probably damaging Het
Asxl3 A G 18: 22,452,414 K132R probably damaging Het
Atp11a T C 8: 12,828,483 M353T probably damaging Het
Atp11b A G 3: 35,806,889 D375G probably damaging Het
BC052040 A G 2: 115,777,023 T286A probably benign Het
Cage1 C T 13: 38,017,362 A656T possibly damaging Het
Casz1 C T 4: 148,939,040 P801S probably damaging Het
Ccdc130 C T 8: 84,263,898 R35Q probably damaging Het
Ccdc144b A G 3: 36,032,884 I187T probably benign Het
Cdc14b A T 13: 64,220,944 probably benign Het
Cox6b2 A G 7: 4,752,087 F63L probably benign Het
Cramp1l A C 17: 24,979,629 V773G possibly damaging Het
Cul7 A G 17: 46,654,522 E542G probably benign Het
Cyp2c55 T C 19: 39,031,346 Y243H possibly damaging Het
Dnah9 C A 11: 66,072,099 D1797Y possibly damaging Het
Dpep2 C A 8: 105,989,312 A298S Het
Dvl3 G A 16: 20,524,076 probably null Het
Enpp3 T C 10: 24,798,274 D376G possibly damaging Het
Ffar4 T C 19: 38,113,784 I289T possibly damaging Het
Gm3417 A G 17: 14,967,680 Y111H probably damaging Het
Gm5565 T C 5: 146,158,039 Y299C probably damaging Het
Gm8765 C T 13: 50,702,092 R589* probably null Het
Gpat3 A T 5: 100,846,922 M39L probably benign Het
Gpr153 T C 4: 152,280,207 L240P probably damaging Het
Gpr182 T C 10: 127,750,648 I145V probably benign Het
H2-Q4 A T 17: 35,379,993 T80S possibly damaging Het
Hnf1a T A 5: 114,950,823 T545S probably benign Het
Kif5b A C 18: 6,208,261 F946V probably benign Het
Krtap16-1 C T 11: 99,986,341 C79Y probably damaging Het
Lama2 A G 10: 27,006,701 V2622A possibly damaging Het
Lrrc37a T A 11: 103,500,549 Q1350L probably damaging Het
Map2k2 G A 10: 81,119,664 V294I probably benign Het
Mtus1 G A 8: 41,083,723 H319Y possibly damaging Het
Ncdn T C 4: 126,750,828 D67G possibly damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nlrp9b A G 7: 20,023,476 I213V possibly damaging Het
Nyap2 G A 1: 81,298,088 R649H possibly damaging Het
Olfr1165-ps T G 2: 88,101,072 D305A unknown Het
Olfr1200 C A 2: 88,767,955 R120L probably damaging Het
Olfr304 A G 7: 86,386,040 S207P probably benign Het
Pi4kb T A 3: 94,993,117 L354Q probably damaging Het
Plekhh2 T C 17: 84,590,762 S944P probably damaging Het
Podn C T 4: 108,021,546 V375M probably damaging Het
Pramef8 C A 4: 143,419,103 Q381K possibly damaging Het
Psmb2 T A 4: 126,706,102 H110Q probably benign Het
Rasip1 A G 7: 45,632,642 E523G possibly damaging Het
Ripor1 T G 8: 105,616,151 C219G probably damaging Het
Rps6ka2 G C 17: 7,300,279 V714L probably damaging Het
Sass6 G T 3: 116,613,998 L254F probably damaging Het
Scarf2 G A 16: 17,806,406 G525E probably damaging Het
Sh3d21 T A 4: 126,152,338 probably benign Het
Sh3tc1 C A 5: 35,706,483 A787S probably benign Het
Skint5 T A 4: 113,655,722 N871I unknown Het
Slc48a1 T G 15: 97,789,952 D62E probably damaging Het
Slc6a21 G A 7: 45,286,974 M157I Het
Slurp2 T C 15: 74,743,112 D60G probably benign Het
Sparcl1 G T 5: 104,093,113 N148K possibly damaging Het
Spsb2 T A 6: 124,810,013 N236K probably benign Het
Sptb G T 12: 76,632,534 probably benign Het
Ssc4d A T 5: 135,961,176 C41S probably damaging Het
Tecta A T 9: 42,375,079 D760E probably benign Het
Tesmin G T 19: 3,389,431 probably benign Het
Tiam1 A C 16: 89,804,888 probably benign Het
Tldc1 T C 8: 119,762,311 N411S probably benign Het
Tnrc6a T C 7: 123,179,723 L1219S probably damaging Het
Tram1 T G 1: 13,569,606 I306L probably benign Het
Trank1 A C 9: 111,362,432 D503A probably damaging Het
Ubac2 T C 14: 121,908,214 F95L probably benign Het
Vmn2r91 A T 17: 18,106,034 M194L probably benign Het
Zdhhc1 G T 8: 105,478,901 H90Q probably damaging Het
Zfp169 C T 13: 48,498,816 V42I probably damaging Het
Zfp81 A G 17: 33,334,413 C476R probably damaging Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
puffer UTSW 2 66226900 missense probably benign 0.12
PIT4696001:Ttc21b UTSW 2 66231219 splice site probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0440:Ttc21b UTSW 2 66236382 missense probably benign 0.03
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3847:Ttc21b UTSW 2 66242679 missense probably damaging 1.00
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4561:Ttc21b UTSW 2 66186218 missense probably damaging 1.00
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6210:Ttc21b UTSW 2 66236354 missense probably benign 0.00
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6456:Ttc21b UTSW 2 66188331 missense probably damaging 0.97
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
R7560:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7561:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7816:Ttc21b UTSW 2 66247361 missense possibly damaging 0.82
R8172:Ttc21b UTSW 2 66252156 missense probably benign 0.01
R8179:Ttc21b UTSW 2 66201480 missense probably benign
R9282:Ttc21b UTSW 2 66226005 missense possibly damaging 0.65
R9336:Ttc21b UTSW 2 66226943 missense probably benign
R9464:Ttc21b UTSW 2 66223522 missense probably damaging 1.00
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATTATGCTAGAAGGTGACTTTC -3'
(R):5'- TCCCCTCGTGCAGAAAGTAG -3'

Sequencing Primer
(F):5'- TGCGTATTTTCCCCAATGTATG -3'
(R):5'- TCCCCTCGTGCAGAAAGTAGAAAAG -3'
Posted On 2021-11-19