Incidental Mutation 'R9047:Olfr1165-ps'
ID 688090
Institutional Source Beutler Lab
Gene Symbol Olfr1165-ps
Ensembl Gene ENSMUSG00000046590
Gene Name olfactory receptor 1165, pseudogene
Synonyms GA_x6K02T2Q125-49593880-49592930, MOR174-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 88101036-88101985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 88101072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 305 (D305A)
Ref Sequence ENSEMBL: ENSMUSP00000149054 (fasta)
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000117860
AA Change: D305A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,939,093 S156T probably damaging Het
4930522L14Rik A G 5: 109,737,554 L146P Het
Adra1a T A 14: 66,638,185 M203K probably damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Akt3 G T 1: 177,059,389 T298K probably damaging Het
Aplf T C 6: 87,663,797 T77A possibly damaging Het
Arid4b T A 13: 14,181,230 W618R probably damaging Het
Asxl3 C A 18: 22,452,408 P130Q probably damaging Het
Asxl3 A G 18: 22,452,414 K132R probably damaging Het
Atp11a T C 8: 12,828,483 M353T probably damaging Het
Atp11b A G 3: 35,806,889 D375G probably damaging Het
BC052040 A G 2: 115,777,023 T286A probably benign Het
Cage1 C T 13: 38,017,362 A656T possibly damaging Het
Casz1 C T 4: 148,939,040 P801S probably damaging Het
Ccdc130 C T 8: 84,263,898 R35Q probably damaging Het
Ccdc144b A G 3: 36,032,884 I187T probably benign Het
Cox6b2 A G 7: 4,752,087 F63L probably benign Het
Cramp1l A C 17: 24,979,629 V773G possibly damaging Het
Cul7 A G 17: 46,654,522 E542G probably benign Het
Cyp2c55 T C 19: 39,031,346 Y243H possibly damaging Het
Dnah9 C A 11: 66,072,099 D1797Y possibly damaging Het
Dpep2 C A 8: 105,989,312 A298S Het
Dvl3 G A 16: 20,524,076 probably null Het
Enpp3 T C 10: 24,798,274 D376G possibly damaging Het
Ffar4 T C 19: 38,113,784 I289T possibly damaging Het
Gm3417 A G 17: 14,967,680 Y111H probably damaging Het
Gm5565 T C 5: 146,158,039 Y299C probably damaging Het
Gm8765 C T 13: 50,702,092 R589* probably null Het
Gpat3 A T 5: 100,846,922 M39L probably benign Het
Gpr153 T C 4: 152,280,207 L240P probably damaging Het
Gpr182 T C 10: 127,750,648 I145V probably benign Het
H2-Q4 A T 17: 35,379,993 T80S possibly damaging Het
Hnf1a T A 5: 114,950,823 T545S probably benign Het
Kif5b A C 18: 6,208,261 F946V probably benign Het
Krtap16-1 C T 11: 99,986,341 C79Y probably damaging Het
Lama2 A G 10: 27,006,701 V2622A possibly damaging Het
Lrrc37a T A 11: 103,500,549 Q1350L probably damaging Het
Map2k2 G A 10: 81,119,664 V294I probably benign Het
Mtus1 G A 8: 41,083,723 H319Y possibly damaging Het
Ncdn T C 4: 126,750,828 D67G possibly damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nlrp9b A G 7: 20,023,476 I213V possibly damaging Het
Nyap2 G A 1: 81,298,088 R649H possibly damaging Het
Olfr1200 C A 2: 88,767,955 R120L probably damaging Het
Olfr304 A G 7: 86,386,040 S207P probably benign Het
Pi4kb T A 3: 94,993,117 L354Q probably damaging Het
Plekhh2 T C 17: 84,590,762 S944P probably damaging Het
Podn C T 4: 108,021,546 V375M probably damaging Het
Pramef8 C A 4: 143,419,103 Q381K possibly damaging Het
Psmb2 T A 4: 126,706,102 H110Q probably benign Het
Rasip1 A G 7: 45,632,642 E523G possibly damaging Het
Ripor1 T G 8: 105,616,151 C219G probably damaging Het
Rps6ka2 G C 17: 7,300,279 V714L probably damaging Het
Sass6 G T 3: 116,613,998 L254F probably damaging Het
Scarf2 G A 16: 17,806,406 G525E probably damaging Het
Sh3tc1 C A 5: 35,706,483 A787S probably benign Het
Skint5 T A 4: 113,655,722 N871I unknown Het
Slc48a1 T G 15: 97,789,952 D62E probably damaging Het
Slc6a21 G A 7: 45,286,974 M157I Het
Slurp2 T C 15: 74,743,112 D60G probably benign Het
Sparcl1 G T 5: 104,093,113 N148K possibly damaging Het
Spsb2 T A 6: 124,810,013 N236K probably benign Het
Ssc4d A T 5: 135,961,176 C41S probably damaging Het
Tecta A T 9: 42,375,079 D760E probably benign Het
Tesmin G T 19: 3,389,431 probably benign Het
Tldc1 T C 8: 119,762,311 N411S probably benign Het
Tnrc6a T C 7: 123,179,723 L1219S probably damaging Het
Tram1 T G 1: 13,569,606 I306L probably benign Het
Trank1 A C 9: 111,362,432 D503A probably damaging Het
Ttc21b T C 2: 66,201,252 H1044R Het
Ubac2 T C 14: 121,908,214 F95L probably benign Het
Vmn2r91 A T 17: 18,106,034 M194L probably benign Het
Zdhhc1 G T 8: 105,478,901 H90Q probably damaging Het
Zfp169 C T 13: 48,498,816 V42I probably damaging Het
Zfp81 A G 17: 33,334,413 C476R probably damaging Het
Other mutations in Olfr1165-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4378:Olfr1165-ps UTSW 2 88101485 missense unknown
R5078:Olfr1165-ps UTSW 2 88101535 missense probably benign 0.03
R6373:Olfr1165-ps UTSW 2 88101845 missense possibly damaging 0.73
R6698:Olfr1165-ps UTSW 2 88101217 missense unknown
R6736:Olfr1165-ps UTSW 2 88101603 missense probably benign 0.03
R7164:Olfr1165-ps UTSW 2 88101832 missense probably damaging 0.97
R7285:Olfr1165-ps UTSW 2 88101705 missense probably damaging 1.00
R7807:Olfr1165-ps UTSW 2 88101565 missense probably benign 0.00
R8040:Olfr1165-ps UTSW 2 88101359 missense unknown
R8509:Olfr1165-ps UTSW 2 88101522 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGCCTGTTGTTTAAATCAAGGCAG -3'
(R):5'- TCAGCATCTTCCATGGGATC -3'

Sequencing Primer
(F):5'- AGAAACTTCACATGTAACTTAGCTG -3'
(R):5'- AGCATCTTCCATGGGATCATTCTC -3'
Posted On 2021-11-19