Incidental Mutation 'R9047:Atp11b'
ID 688093
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene Name ATPase, class VI, type 11B
Synonyms 1110019I14Rik
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 35808255-35910425 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35861038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 375 (D375G)
Ref Sequence ENSEMBL: ENSMUSP00000029257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
AlphaFold Q6DFW5
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: D375G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: D375G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: D175G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: D175G

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.8276 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35,863,525 (GRCm39) splice site probably null
IGL00722:Atp11b APN 3 35,874,084 (GRCm39) missense probably damaging 1.00
IGL00725:Atp11b APN 3 35,881,222 (GRCm39) missense probably damaging 0.97
IGL01514:Atp11b APN 3 35,891,130 (GRCm39) missense probably damaging 1.00
IGL01532:Atp11b APN 3 35,903,651 (GRCm39) nonsense probably null
IGL01789:Atp11b APN 3 35,843,741 (GRCm39) missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35,885,612 (GRCm39) missense probably damaging 1.00
IGL02009:Atp11b APN 3 35,868,301 (GRCm39) missense probably benign 0.07
IGL02049:Atp11b APN 3 35,854,642 (GRCm39) missense probably damaging 0.99
IGL02952:Atp11b APN 3 35,882,844 (GRCm39) missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35,881,140 (GRCm39) missense probably benign 0.00
R0044:Atp11b UTSW 3 35,866,401 (GRCm39) missense probably damaging 0.99
R0254:Atp11b UTSW 3 35,866,259 (GRCm39) missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35,891,163 (GRCm39) missense probably damaging 1.00
R0541:Atp11b UTSW 3 35,861,093 (GRCm39) missense probably damaging 0.99
R0653:Atp11b UTSW 3 35,893,343 (GRCm39) missense probably damaging 0.99
R0790:Atp11b UTSW 3 35,887,072 (GRCm39) missense probably damaging 1.00
R1083:Atp11b UTSW 3 35,832,162 (GRCm39) splice site probably benign
R1371:Atp11b UTSW 3 35,860,918 (GRCm39) missense probably damaging 0.97
R1458:Atp11b UTSW 3 35,843,707 (GRCm39) missense probably damaging 1.00
R1875:Atp11b UTSW 3 35,893,296 (GRCm39) missense probably damaging 1.00
R1921:Atp11b UTSW 3 35,888,474 (GRCm39) missense probably damaging 1.00
R2008:Atp11b UTSW 3 35,909,271 (GRCm39) missense probably damaging 0.97
R2065:Atp11b UTSW 3 35,893,223 (GRCm39) missense probably damaging 1.00
R2112:Atp11b UTSW 3 35,891,677 (GRCm39) missense probably damaging 1.00
R2228:Atp11b UTSW 3 35,861,091 (GRCm39) missense probably damaging 1.00
R2270:Atp11b UTSW 3 35,864,283 (GRCm39) splice site probably null
R2273:Atp11b UTSW 3 35,882,762 (GRCm39) missense probably benign 0.04
R2439:Atp11b UTSW 3 35,868,233 (GRCm39) missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35,909,294 (GRCm39) missense probably damaging 0.99
R4181:Atp11b UTSW 3 35,854,714 (GRCm39) missense probably benign 0.19
R4181:Atp11b UTSW 3 35,843,707 (GRCm39) missense probably damaging 1.00
R4714:Atp11b UTSW 3 35,888,543 (GRCm39) missense probably benign 0.02
R4923:Atp11b UTSW 3 35,889,528 (GRCm39) critical splice donor site probably null
R4937:Atp11b UTSW 3 35,861,157 (GRCm39) splice site probably null
R5013:Atp11b UTSW 3 35,888,532 (GRCm39) missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35,863,510 (GRCm39) missense probably benign 0.41
R5171:Atp11b UTSW 3 35,887,086 (GRCm39) missense probably damaging 1.00
R5200:Atp11b UTSW 3 35,891,156 (GRCm39) missense probably benign 0.21
R5465:Atp11b UTSW 3 35,864,333 (GRCm39) missense probably benign 0.00
R5651:Atp11b UTSW 3 35,909,289 (GRCm39) missense probably damaging 1.00
R5689:Atp11b UTSW 3 35,888,501 (GRCm39) missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35,891,665 (GRCm39) missense probably benign 0.12
R5807:Atp11b UTSW 3 35,866,428 (GRCm39) missense probably damaging 1.00
R5888:Atp11b UTSW 3 35,891,696 (GRCm39) missense probably benign 0.15
R6059:Atp11b UTSW 3 35,868,326 (GRCm39) missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35,861,050 (GRCm39) missense probably damaging 1.00
R6359:Atp11b UTSW 3 35,832,210 (GRCm39) missense probably benign 0.04
R6367:Atp11b UTSW 3 35,838,686 (GRCm39) missense probably damaging 1.00
R6577:Atp11b UTSW 3 35,893,311 (GRCm39) missense probably damaging 0.99
R6818:Atp11b UTSW 3 35,868,329 (GRCm39) missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35,895,185 (GRCm39) missense probably benign
R7178:Atp11b UTSW 3 35,874,099 (GRCm39) missense probably benign 0.34
R7614:Atp11b UTSW 3 35,864,259 (GRCm39) splice site probably null
R7729:Atp11b UTSW 3 35,832,256 (GRCm39) missense probably damaging 0.97
R7910:Atp11b UTSW 3 35,885,652 (GRCm39) missense possibly damaging 0.68
R7967:Atp11b UTSW 3 35,895,192 (GRCm39) missense probably benign 0.03
R8085:Atp11b UTSW 3 35,895,185 (GRCm39) missense probably benign
R8095:Atp11b UTSW 3 35,888,565 (GRCm39) missense probably damaging 1.00
R8499:Atp11b UTSW 3 35,864,854 (GRCm39) missense probably benign 0.01
R8672:Atp11b UTSW 3 35,874,066 (GRCm39) missense probably benign 0.19
R9046:Atp11b UTSW 3 35,852,740 (GRCm39) splice site probably benign
R9065:Atp11b UTSW 3 35,887,131 (GRCm39) critical splice donor site probably null
R9713:Atp11b UTSW 3 35,885,560 (GRCm39) missense probably damaging 1.00
R9761:Atp11b UTSW 3 35,903,621 (GRCm39) missense probably benign 0.25
R9761:Atp11b UTSW 3 35,903,616 (GRCm39) missense probably damaging 1.00
R9761:Atp11b UTSW 3 35,903,607 (GRCm39) nonsense probably null
Z1088:Atp11b UTSW 3 35,866,362 (GRCm39) missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35,861,003 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCCAGTAAGCAGAGGAGAT -3'
(R):5'- TGCTCTGGTAGAACCTTTGTGA -3'

Sequencing Primer
(F):5'- ATGCTAGGTTACCTCAGGATATGG -3'
(R):5'- TCTGGTAGAACCTTTGTGATATTTTC -3'
Posted On 2021-11-19