Incidental Mutation 'R9047:Gpr153'
ID 688104
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene Name G protein-coupled receptor 153
Synonyms 1110065N12Rik, PGR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 152274232-152285337 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152280207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 240 (L240P)
Ref Sequence ENSEMBL: ENSMUSP00000052742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000105650] [ENSMUST00000105651]
AlphaFold Q8K0Z9
Predicted Effect probably damaging
Transcript: ENSMUST00000055754
AA Change: L240P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804
AA Change: L240P

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105650
AA Change: L240P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804
AA Change: L240P

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105651
AA Change: L240P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804
AA Change: L240P

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,939,093 S156T probably damaging Het
4930522L14Rik A G 5: 109,737,554 L146P Het
Adra1a T A 14: 66,638,185 M203K probably damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Akt3 G T 1: 177,059,389 T298K probably damaging Het
Aldh4a1 G T 4: 139,623,200 probably benign Het
Aplf T C 6: 87,663,797 T77A possibly damaging Het
Arid4b T A 13: 14,181,230 W618R probably damaging Het
Asxl3 C A 18: 22,452,408 P130Q probably damaging Het
Asxl3 A G 18: 22,452,414 K132R probably damaging Het
Atp11a T C 8: 12,828,483 M353T probably damaging Het
Atp11b A G 3: 35,806,889 D375G probably damaging Het
BC052040 A G 2: 115,777,023 T286A probably benign Het
Cage1 C T 13: 38,017,362 A656T possibly damaging Het
Casz1 C T 4: 148,939,040 P801S probably damaging Het
Ccdc130 C T 8: 84,263,898 R35Q probably damaging Het
Ccdc144b A G 3: 36,032,884 I187T probably benign Het
Cdc14b A T 13: 64,220,944 probably benign Het
Cox6b2 A G 7: 4,752,087 F63L probably benign Het
Cramp1l A C 17: 24,979,629 V773G possibly damaging Het
Cul7 A G 17: 46,654,522 E542G probably benign Het
Cyp2c55 T C 19: 39,031,346 Y243H possibly damaging Het
Dnah9 C A 11: 66,072,099 D1797Y possibly damaging Het
Dpep2 C A 8: 105,989,312 A298S Het
Dvl3 G A 16: 20,524,076 probably null Het
Enpp3 T C 10: 24,798,274 D376G possibly damaging Het
Ffar4 T C 19: 38,113,784 I289T possibly damaging Het
Gm3417 A G 17: 14,967,680 Y111H probably damaging Het
Gm5565 T C 5: 146,158,039 Y299C probably damaging Het
Gm8765 C T 13: 50,702,092 R589* probably null Het
Gpat3 A T 5: 100,846,922 M39L probably benign Het
Gpr182 T C 10: 127,750,648 I145V probably benign Het
H2-Q4 A T 17: 35,379,993 T80S possibly damaging Het
Hnf1a T A 5: 114,950,823 T545S probably benign Het
Kif5b A C 18: 6,208,261 F946V probably benign Het
Krtap16-1 C T 11: 99,986,341 C79Y probably damaging Het
Lama2 A G 10: 27,006,701 V2622A possibly damaging Het
Lrrc37a T A 11: 103,500,549 Q1350L probably damaging Het
Map2k2 G A 10: 81,119,664 V294I probably benign Het
Mtus1 G A 8: 41,083,723 H319Y possibly damaging Het
Ncdn T C 4: 126,750,828 D67G possibly damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nlrp9b A G 7: 20,023,476 I213V possibly damaging Het
Nyap2 G A 1: 81,298,088 R649H possibly damaging Het
Olfr1165-ps T G 2: 88,101,072 D305A unknown Het
Olfr1200 C A 2: 88,767,955 R120L probably damaging Het
Olfr304 A G 7: 86,386,040 S207P probably benign Het
Pi4kb T A 3: 94,993,117 L354Q probably damaging Het
Plekhh2 T C 17: 84,590,762 S944P probably damaging Het
Podn C T 4: 108,021,546 V375M probably damaging Het
Pramef8 C A 4: 143,419,103 Q381K possibly damaging Het
Psmb2 T A 4: 126,706,102 H110Q probably benign Het
Rasip1 A G 7: 45,632,642 E523G possibly damaging Het
Ripor1 T G 8: 105,616,151 C219G probably damaging Het
Rps6ka2 G C 17: 7,300,279 V714L probably damaging Het
Sass6 G T 3: 116,613,998 L254F probably damaging Het
Scarf2 G A 16: 17,806,406 G525E probably damaging Het
Sh3d21 T A 4: 126,152,338 probably benign Het
Sh3tc1 C A 5: 35,706,483 A787S probably benign Het
Skint5 T A 4: 113,655,722 N871I unknown Het
Slc48a1 T G 15: 97,789,952 D62E probably damaging Het
Slc6a21 G A 7: 45,286,974 M157I Het
Slurp2 T C 15: 74,743,112 D60G probably benign Het
Sparcl1 G T 5: 104,093,113 N148K possibly damaging Het
Spsb2 T A 6: 124,810,013 N236K probably benign Het
Sptb G T 12: 76,632,534 probably benign Het
Ssc4d A T 5: 135,961,176 C41S probably damaging Het
Tecta A T 9: 42,375,079 D760E probably benign Het
Tesmin G T 19: 3,389,431 probably benign Het
Tiam1 A C 16: 89,804,888 probably benign Het
Tldc1 T C 8: 119,762,311 N411S probably benign Het
Tnrc6a T C 7: 123,179,723 L1219S probably damaging Het
Tram1 T G 1: 13,569,606 I306L probably benign Het
Trank1 A C 9: 111,362,432 D503A probably damaging Het
Ttc21b T C 2: 66,201,252 H1044R Het
Ubac2 T C 14: 121,908,214 F95L probably benign Het
Vmn2r91 A T 17: 18,106,034 M194L probably benign Het
Zdhhc1 G T 8: 105,478,901 H90Q probably damaging Het
Zfp169 C T 13: 48,498,816 V42I probably damaging Het
Zfp81 A G 17: 33,334,413 C476R probably damaging Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152281966 unclassified probably benign
IGL01368:Gpr153 APN 4 152282994 missense probably benign 0.40
IGL01568:Gpr153 APN 4 152282368 splice site probably null
IGL01672:Gpr153 APN 4 152279913 nonsense probably null
R0735:Gpr153 UTSW 4 152279373 nonsense probably null
R0925:Gpr153 UTSW 4 152281874 missense probably benign
R1302:Gpr153 UTSW 4 152279943 missense probably damaging 1.00
R1829:Gpr153 UTSW 4 152282392 missense possibly damaging 0.70
R2041:Gpr153 UTSW 4 152283353 missense probably benign
R4698:Gpr153 UTSW 4 152281783 missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152279883 missense probably damaging 0.99
R5623:Gpr153 UTSW 4 152281941 missense possibly damaging 0.89
R5800:Gpr153 UTSW 4 152280077 nonsense probably null
R5940:Gpr153 UTSW 4 152283375 missense probably benign 0.12
R6773:Gpr153 UTSW 4 152279300 missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152279363 missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152282401 missense probably benign 0.01
R8170:Gpr153 UTSW 4 152280177 missense probably damaging 1.00
R8699:Gpr153 UTSW 4 152279101 start gained probably benign
R8701:Gpr153 UTSW 4 152279101 start gained probably benign
R8732:Gpr153 UTSW 4 152279101 start gained probably benign
R9383:Gpr153 UTSW 4 152283059 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACGAGCGAGCGTTTCTAC -3'
(R):5'- AGTGCTAACTGACAGCTCAAAAG -3'

Sequencing Primer
(F):5'- AGCGTTTCTACACCCACGG -3'
(R):5'- GTCAGGTTTATCATTTCAGCCATCAG -3'
Posted On 2021-11-19