Incidental Mutation 'R9047:Ssc4d'
ID 688110
Institutional Source Beutler Lab
Gene Symbol Ssc4d
Ensembl Gene ENSMUSG00000029699
Gene Name scavenger receptor cysteine rich family, 4 domains
Synonyms Srcrb4d, C330016E03Rik
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 135989074-136003389 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 135990030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 41 (C41S)
Ref Sequence ENSEMBL: ENSMUSP00000050439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054895] [ENSMUST00000111150] [ENSMUST00000111152] [ENSMUST00000111153] [ENSMUST00000153823] [ENSMUST00000154181]
AlphaFold A1L0T3
Predicted Effect probably damaging
Transcript: ENSMUST00000054895
AA Change: C41S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050439
Gene: ENSMUSG00000029699
AA Change: C41S

DomainStartEndE-ValueType
SR 32 132 1.99e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111150
AA Change: C15S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106780
Gene: ENSMUSG00000029699
AA Change: C15S

DomainStartEndE-ValueType
SR 6 106 1.99e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111152
AA Change: C493S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106782
Gene: ENSMUSG00000029699
AA Change: C493S

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111153
AA Change: C493S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106783
Gene: ENSMUSG00000029699
AA Change: C493S

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153823
SMART Domains Protein: ENSMUSP00000122958
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 1 101 6.78e-54 SMART
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154181
SMART Domains Protein: ENSMUSP00000123008
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154696
SMART Domains Protein: ENSMUSP00000117071
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 2 61 5.24e-5 SMART
low complexity region 88 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Ssc4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Ssc4d APN 5 135,996,817 (GRCm39) missense probably damaging 1.00
IGL02585:Ssc4d APN 5 135,999,192 (GRCm39) missense possibly damaging 0.74
IGL02821:Ssc4d APN 5 135,994,923 (GRCm39) splice site probably benign
IGL03343:Ssc4d APN 5 135,990,028 (GRCm39) nonsense probably null
R2051:Ssc4d UTSW 5 135,999,118 (GRCm39) missense probably benign 0.00
R2069:Ssc4d UTSW 5 135,999,171 (GRCm39) missense possibly damaging 0.50
R2508:Ssc4d UTSW 5 135,994,461 (GRCm39) missense probably damaging 1.00
R2901:Ssc4d UTSW 5 135,993,517 (GRCm39) missense possibly damaging 0.57
R2902:Ssc4d UTSW 5 135,993,517 (GRCm39) missense possibly damaging 0.57
R2939:Ssc4d UTSW 5 135,994,578 (GRCm39) missense possibly damaging 0.61
R3081:Ssc4d UTSW 5 135,994,578 (GRCm39) missense possibly damaging 0.61
R4038:Ssc4d UTSW 5 135,999,170 (GRCm39) missense possibly damaging 0.50
R4181:Ssc4d UTSW 5 135,990,778 (GRCm39) missense possibly damaging 0.85
R4590:Ssc4d UTSW 5 135,993,538 (GRCm39) missense probably benign 0.00
R4771:Ssc4d UTSW 5 135,999,074 (GRCm39) missense probably damaging 1.00
R5411:Ssc4d UTSW 5 135,992,254 (GRCm39) missense probably benign 0.40
R5583:Ssc4d UTSW 5 135,999,050 (GRCm39) missense probably damaging 0.99
R5662:Ssc4d UTSW 5 135,989,748 (GRCm39) makesense probably null
R5681:Ssc4d UTSW 5 135,999,074 (GRCm39) missense probably damaging 1.00
R6357:Ssc4d UTSW 5 135,994,950 (GRCm39) missense probably benign 0.00
R6962:Ssc4d UTSW 5 135,991,775 (GRCm39) critical splice donor site probably null
R7258:Ssc4d UTSW 5 135,991,941 (GRCm39) missense probably damaging 1.00
R7274:Ssc4d UTSW 5 135,996,810 (GRCm39) missense possibly damaging 0.66
R7360:Ssc4d UTSW 5 135,994,965 (GRCm39) missense probably damaging 1.00
R7563:Ssc4d UTSW 5 135,991,887 (GRCm39) missense probably damaging 1.00
Z1177:Ssc4d UTSW 5 135,989,920 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTGCTCTCATCTCCTCG -3'
(R):5'- ACCCGTGTATATGCATGATATGTTC -3'

Sequencing Primer
(F):5'- CTCGGCATTTGACATTGTCCAAGAG -3'
(R):5'- TGCATGATATGTTCACACATGTG -3'
Posted On 2021-11-19