Incidental Mutation 'R9047:Or14a258'
ID 688118
Institutional Source Beutler Lab
Gene Symbol Or14a258
Ensembl Gene ENSMUSG00000062426
Gene Name olfactory receptor family 14 subfamily A member 258
Synonyms GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P, Olfr304
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86034865-86035866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86035248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 207 (S207P)
Ref Sequence ENSEMBL: ENSMUSP00000076449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077210]
AlphaFold Q7TS03
Predicted Effect probably benign
Transcript: ENSMUST00000077210
AA Change: S207P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: S207P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8.9e-38 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Or14a258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Or14a258 APN 7 86,035,208 (GRCm39) missense possibly damaging 0.95
IGL02152:Or14a258 APN 7 86,035,251 (GRCm39) missense probably benign 0.00
IGL02540:Or14a258 APN 7 86,035,386 (GRCm39) missense possibly damaging 0.86
IGL03108:Or14a258 APN 7 86,034,929 (GRCm39) missense possibly damaging 0.95
IGL03374:Or14a258 APN 7 86,035,574 (GRCm39) missense probably damaging 1.00
R0040:Or14a258 UTSW 7 86,035,715 (GRCm39) missense probably benign 0.01
R0130:Or14a258 UTSW 7 86,035,514 (GRCm39) missense probably damaging 1.00
R0194:Or14a258 UTSW 7 86,035,582 (GRCm39) nonsense probably null
R0267:Or14a258 UTSW 7 86,035,475 (GRCm39) missense possibly damaging 0.64
R1026:Or14a258 UTSW 7 86,035,467 (GRCm39) missense probably damaging 0.98
R1865:Or14a258 UTSW 7 86,035,769 (GRCm39) missense probably damaging 1.00
R2090:Or14a258 UTSW 7 86,035,289 (GRCm39) missense probably benign 0.01
R3607:Or14a258 UTSW 7 86,034,903 (GRCm39) missense probably benign
R3861:Or14a258 UTSW 7 86,035,331 (GRCm39) missense possibly damaging 0.60
R3909:Or14a258 UTSW 7 86,035,182 (GRCm39) missense probably benign 0.05
R4113:Or14a258 UTSW 7 86,035,733 (GRCm39) missense possibly damaging 0.83
R5268:Or14a258 UTSW 7 86,034,867 (GRCm39) makesense probably null
R5649:Or14a258 UTSW 7 86,035,521 (GRCm39) missense probably damaging 1.00
R6343:Or14a258 UTSW 7 86,035,059 (GRCm39) nonsense probably null
R7716:Or14a258 UTSW 7 86,035,262 (GRCm39) missense probably benign 0.22
R8118:Or14a258 UTSW 7 86,034,976 (GRCm39) nonsense probably null
R9503:Or14a258 UTSW 7 86,035,228 (GRCm39) missense probably benign 0.00
R9528:Or14a258 UTSW 7 86,035,059 (GRCm39) nonsense probably null
X0054:Or14a258 UTSW 7 86,034,938 (GRCm39) missense probably benign 0.00
X0063:Or14a258 UTSW 7 86,035,700 (GRCm39) missense probably damaging 1.00
Z1186:Or14a258 UTSW 7 86,035,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCAGCACAGTATACAGCAC -3'
(R):5'- CCTGGGCTACTGGAATTCTG -3'

Sequencing Primer
(F):5'- CTGTAATAGACGGTATATCTGAGGG -3'
(R):5'- CTGTTTGGAGCTTTATACACAGC -3'
Posted On 2021-11-19