Incidental Mutation 'R9047:Tnrc6a'
ID 688119
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Name trinucleotide repeat containing 6a
Synonyms 3110054G10Rik, 2010321I05Rik, Tnrc6, CAGH26, D130023A07Rik
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 122723108-122794519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122778946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 1219 (L1219S)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
AlphaFold Q3UHK8
Predicted Effect probably damaging
Transcript: ENSMUST00000094053
AA Change: L1219S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: L1219S

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000206014
AA Change: L82S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 122,770,003 (GRCm39) missense probably benign 0.04
IGL00580:Tnrc6a APN 7 122,773,501 (GRCm39) missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 122,770,717 (GRCm39) missense probably benign 0.04
IGL02004:Tnrc6a APN 7 122,780,589 (GRCm39) missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 122,751,414 (GRCm39) intron probably benign
IGL02220:Tnrc6a APN 7 122,769,679 (GRCm39) missense probably benign
IGL02436:Tnrc6a APN 7 122,783,438 (GRCm39) nonsense probably null
IGL02670:Tnrc6a APN 7 122,770,535 (GRCm39) missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 122,770,696 (GRCm39) missense probably damaging 1.00
0152:Tnrc6a UTSW 7 122,779,877 (GRCm39) missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 122,769,617 (GRCm39) missense probably benign 0.00
R0008:Tnrc6a UTSW 7 122,769,617 (GRCm39) missense probably benign 0.00
R0369:Tnrc6a UTSW 7 122,770,083 (GRCm39) missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 122,785,951 (GRCm39) splice site probably benign
R0566:Tnrc6a UTSW 7 122,770,136 (GRCm39) missense probably benign 0.00
R0600:Tnrc6a UTSW 7 122,771,039 (GRCm39) missense probably benign 0.14
R0751:Tnrc6a UTSW 7 122,769,563 (GRCm39) missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 122,769,563 (GRCm39) missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 122,783,474 (GRCm39) missense probably benign 0.02
R1405:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 122,776,098 (GRCm39) missense probably benign 0.08
R1709:Tnrc6a UTSW 7 122,769,205 (GRCm39) missense probably benign 0.10
R1776:Tnrc6a UTSW 7 122,770,520 (GRCm39) missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 122,792,140 (GRCm39) missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R1876:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R2010:Tnrc6a UTSW 7 122,770,269 (GRCm39) missense probably benign 0.26
R2086:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R2089:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2091:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2091:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2511:Tnrc6a UTSW 7 122,770,315 (GRCm39) missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 122,792,172 (GRCm39) makesense probably null
R2850:Tnrc6a UTSW 7 122,779,023 (GRCm39) missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 122,780,607 (GRCm39) missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 122,769,344 (GRCm39) missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 122,770,903 (GRCm39) missense probably benign 0.00
R4439:Tnrc6a UTSW 7 122,751,405 (GRCm39) nonsense probably null
R4525:Tnrc6a UTSW 7 122,779,005 (GRCm39) missense probably benign
R4578:Tnrc6a UTSW 7 122,783,444 (GRCm39) missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 122,783,512 (GRCm39) critical splice donor site probably null
R4711:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 122,791,313 (GRCm39) missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 122,789,220 (GRCm39) missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 122,769,134 (GRCm39) missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 122,791,836 (GRCm39) missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 122,789,095 (GRCm39) missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 122,785,946 (GRCm39) critical splice donor site probably null
R5239:Tnrc6a UTSW 7 122,785,842 (GRCm39) missense probably benign
R5604:Tnrc6a UTSW 7 122,773,459 (GRCm39) missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 122,769,299 (GRCm39) missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 122,785,888 (GRCm39) missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 122,781,603 (GRCm39) missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 122,742,965 (GRCm39) splice site probably null
R6284:Tnrc6a UTSW 7 122,770,558 (GRCm39) missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 122,770,297 (GRCm39) missense probably benign 0.01
R6420:Tnrc6a UTSW 7 122,770,297 (GRCm39) missense probably benign 0.01
R6575:Tnrc6a UTSW 7 122,769,133 (GRCm39) missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 122,771,222 (GRCm39) missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 122,786,668 (GRCm39) missense probably benign 0.17
R6968:Tnrc6a UTSW 7 122,781,650 (GRCm39) missense probably benign 0.05
R7216:Tnrc6a UTSW 7 122,770,718 (GRCm39) missense probably benign 0.01
R7260:Tnrc6a UTSW 7 122,785,813 (GRCm39) missense probably benign 0.36
R7299:Tnrc6a UTSW 7 122,770,136 (GRCm39) missense probably benign
R7322:Tnrc6a UTSW 7 122,770,731 (GRCm39) missense probably benign 0.09
R7500:Tnrc6a UTSW 7 122,772,673 (GRCm39) splice site probably null
R7872:Tnrc6a UTSW 7 122,779,057 (GRCm39) missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 122,769,294 (GRCm39) missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 122,769,936 (GRCm39) missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 122,791,346 (GRCm39) missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 122,761,794 (GRCm39) missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 122,791,346 (GRCm39) missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 122,783,438 (GRCm39) nonsense probably null
R8552:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R8767:Tnrc6a UTSW 7 122,783,133 (GRCm39) unclassified probably benign
R9147:Tnrc6a UTSW 7 122,785,667 (GRCm39) intron probably benign
R9153:Tnrc6a UTSW 7 122,773,519 (GRCm39) missense probably damaging 1.00
R9166:Tnrc6a UTSW 7 122,786,624 (GRCm39) missense probably damaging 1.00
R9179:Tnrc6a UTSW 7 122,791,881 (GRCm39) missense probably benign 0.44
R9192:Tnrc6a UTSW 7 122,789,176 (GRCm39) missense probably damaging 1.00
R9457:Tnrc6a UTSW 7 122,778,958 (GRCm39) missense probably benign 0.24
R9778:Tnrc6a UTSW 7 122,769,635 (GRCm39) missense probably benign 0.43
X0064:Tnrc6a UTSW 7 122,769,021 (GRCm39) missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 122,761,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGGACCTTGGACTCTTTCC -3'
(R):5'- AAGGGTATGGTTGATTATGCTCAGATC -3'

Sequencing Primer
(F):5'- GTGATGACCAAGTACTTACATGTC -3'
(R):5'- CTTTGGAAATCTGAGGCC -3'
Posted On 2021-11-19