Mutagenetix > Incidental Mutation

Incidental Mutation 'R9047:Tecta'

688127

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R9047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42375079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 760 (D760E)

Ref Sequence

ENSEMBL: ENSMUSP00000040262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

AlphaFold

O08523

Predicted Effect

probably benign
Transcript: ENSMUST00000042190
AA Change: D760E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: D760E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160940
AA Change: D760E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: D760E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,939,093	S156T	probably damaging	Het
4930522L14Rik	A	G	5: 109,737,554	L146P		Het
Adra1a	T	A	14: 66,638,185	M203K	probably damaging	Het
Adtrp	G	A	13: 41,816,160	T89I	possibly damaging	Het
Akt3	G	T	1: 177,059,389	T298K	probably damaging	Het
Aldh4a1	G	T	4: 139,623,200		probably benign	Het
Aplf	T	C	6: 87,663,797	T77A	possibly damaging	Het
Arid4b	T	A	13: 14,181,230	W618R	probably damaging	Het
Asxl3	C	A	18: 22,452,408	P130Q	probably damaging	Het
Asxl3	A	G	18: 22,452,414	K132R	probably damaging	Het
Atp11a	T	C	8: 12,828,483	M353T	probably damaging	Het
Atp11b	A	G	3: 35,806,889	D375G	probably damaging	Het
BC052040	A	G	2: 115,777,023	T286A	probably benign	Het
Cage1	C	T	13: 38,017,362	A656T	possibly damaging	Het
Casz1	C	T	4: 148,939,040	P801S	probably damaging	Het
Ccdc130	C	T	8: 84,263,898	R35Q	probably damaging	Het
Ccdc144b	A	G	3: 36,032,884	I187T	probably benign	Het
Cdc14b	A	T	13: 64,220,944		probably benign	Het
Cox6b2	A	G	7: 4,752,087	F63L	probably benign	Het
Cramp1l	A	C	17: 24,979,629	V773G	possibly damaging	Het
Cul7	A	G	17: 46,654,522	E542G	probably benign	Het
Cyp2c55	T	C	19: 39,031,346	Y243H	possibly damaging	Het
Dnah9	C	A	11: 66,072,099	D1797Y	possibly damaging	Het
Dpep2	C	A	8: 105,989,312	A298S		Het
Dvl3	G	A	16: 20,524,076		probably null	Het
Enpp3	T	C	10: 24,798,274	D376G	possibly damaging	Het
Ffar4	T	C	19: 38,113,784	I289T	possibly damaging	Het
Gm3417	A	G	17: 14,967,680	Y111H	probably damaging	Het
Gm5565	T	C	5: 146,158,039	Y299C	probably damaging	Het
Gm8765	C	T	13: 50,702,092	R589*	probably null	Het
Gpat3	A	T	5: 100,846,922	M39L	probably benign	Het
Gpr153	T	C	4: 152,280,207	L240P	probably damaging	Het
Gpr182	T	C	10: 127,750,648	I145V	probably benign	Het
H2-Q4	A	T	17: 35,379,993	T80S	possibly damaging	Het
Hnf1a	T	A	5: 114,950,823	T545S	probably benign	Het
Kif5b	A	C	18: 6,208,261	F946V	probably benign	Het
Krtap16-1	C	T	11: 99,986,341	C79Y	probably damaging	Het
Lama2	A	G	10: 27,006,701	V2622A	possibly damaging	Het
Lrrc37a	T	A	11: 103,500,549	Q1350L	probably damaging	Het
Map2k2	G	A	10: 81,119,664	V294I	probably benign	Het
Mtus1	G	A	8: 41,083,723	H319Y	possibly damaging	Het
Ncdn	T	C	4: 126,750,828	D67G	possibly damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp9b	A	G	7: 20,023,476	I213V	possibly damaging	Het
Nyap2	G	A	1: 81,298,088	R649H	possibly damaging	Het
Olfr1165-ps	T	G	2: 88,101,072	D305A	unknown	Het
Olfr1200	C	A	2: 88,767,955	R120L	probably damaging	Het
Olfr304	A	G	7: 86,386,040	S207P	probably benign	Het
Pi4kb	T	A	3: 94,993,117	L354Q	probably damaging	Het
Plekhh2	T	C	17: 84,590,762	S944P	probably damaging	Het
Podn	C	T	4: 108,021,546	V375M	probably damaging	Het
Pramef8	C	A	4: 143,419,103	Q381K	possibly damaging	Het
Psmb2	T	A	4: 126,706,102	H110Q	probably benign	Het
Rasip1	A	G	7: 45,632,642	E523G	possibly damaging	Het
Ripor1	T	G	8: 105,616,151	C219G	probably damaging	Het
Rps6ka2	G	C	17: 7,300,279	V714L	probably damaging	Het
Sass6	G	T	3: 116,613,998	L254F	probably damaging	Het
Scarf2	G	A	16: 17,806,406	G525E	probably damaging	Het
Sh3d21	T	A	4: 126,152,338		probably benign	Het
Sh3tc1	C	A	5: 35,706,483	A787S	probably benign	Het
Skint5	T	A	4: 113,655,722	N871I	unknown	Het
Slc48a1	T	G	15: 97,789,952	D62E	probably damaging	Het
Slc6a21	G	A	7: 45,286,974	M157I		Het
Slurp2	T	C	15: 74,743,112	D60G	probably benign	Het
Sparcl1	G	T	5: 104,093,113	N148K	possibly damaging	Het
Spsb2	T	A	6: 124,810,013	N236K	probably benign	Het
Sptb	G	T	12: 76,632,534		probably benign	Het
Ssc4d	A	T	5: 135,961,176	C41S	probably damaging	Het
Tesmin	G	T	19: 3,389,431		probably benign	Het
Tiam1	A	C	16: 89,804,888		probably benign	Het
Tldc1	T	C	8: 119,762,311	N411S	probably benign	Het
Tnrc6a	T	C	7: 123,179,723	L1219S	probably damaging	Het
Tram1	T	G	1: 13,569,606	I306L	probably benign	Het
Trank1	A	C	9: 111,362,432	D503A	probably damaging	Het
Ttc21b	T	C	2: 66,201,252	H1044R		Het
Ubac2	T	C	14: 121,908,214	F95L	probably benign	Het
Vmn2r91	A	T	17: 18,106,034	M194L	probably benign	Het
Zdhhc1	G	T	8: 105,478,901	H90Q	probably damaging	Het
Zfp169	C	T	13: 48,498,816	V42I	probably damaging	Het
Zfp81	A	G	17: 33,334,413	C476R	probably damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
cover	UTSW	9	42343887	missense	probably benign	0.05
lid	UTSW	9	42373110	missense	probably damaging	0.99
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0691:Tecta	UTSW	9	42384341	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1216:Tecta	UTSW	9	42377907	missense	probably benign	0.44
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5387:Tecta	UTSW	9	42375063	missense	probably damaging	0.98
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6850:Tecta	UTSW	9	42343838	missense	probably benign	0.20
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7307:Tecta	UTSW	9	42377992	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00
R7939:Tecta	UTSW	9	42388223	missense	probably damaging	0.99
R7966:Tecta	UTSW	9	42394962	missense	probably damaging	0.98
R7967:Tecta	UTSW	9	42377955	missense	possibly damaging	0.95
R8000:Tecta	UTSW	9	42367184	nonsense	probably null
R8064:Tecta	UTSW	9	42394955	missense	possibly damaging	0.94
R8117:Tecta	UTSW	9	42377631	missense	probably damaging	1.00
R8176:Tecta	UTSW	9	42359169	missense	probably damaging	0.97
R8284:Tecta	UTSW	9	42378029	missense	possibly damaging	0.89
R8315:Tecta	UTSW	9	42387825	critical splice acceptor site	probably null
R8321:Tecta	UTSW	9	42373053	missense	probably damaging	1.00
R8332:Tecta	UTSW	9	42375014	missense	probably damaging	1.00
R8437:Tecta	UTSW	9	42332560	missense	probably damaging	0.98
R8496:Tecta	UTSW	9	42330251	missense	probably benign	0.01
R8514:Tecta	UTSW	9	42373110	missense	probably damaging	0.99
R8683:Tecta	UTSW	9	42366972	missense	probably damaging	0.96
R8856:Tecta	UTSW	9	42373301	missense	probably benign	0.13
R8886:Tecta	UTSW	9	42367063	missense	probably benign	0.37
R9106:Tecta	UTSW	9	42367183	missense	probably benign	0.05
R9332:Tecta	UTSW	9	42372897	missense	probably damaging	1.00
R9352:Tecta	UTSW	9	42337851	missense	probably damaging	1.00
R9462:Tecta	UTSW	9	42337280	missense	probably damaging	1.00
R9535:Tecta	UTSW	9	42359463	missense	probably damaging	0.99
R9564:Tecta	UTSW	9	42337827	missense	probably damaging	0.97
R9592:Tecta	UTSW	9	42338942	missense	probably damaging	1.00
R9715:Tecta	UTSW	9	42375300	missense	probably damaging	1.00
Z1176:Tecta	UTSW	9	42392094	missense	probably damaging	0.99
Z1177:Tecta	UTSW	9	42375576	missense	probably benign	0.00
Z1177:Tecta	UTSW	9	42392070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAGCCAGAGGAAGAATG -3'
(R):5'- GATGTCTACTGCTTCAACAAGACC -3'

Sequencing Primer
(F):5'- CAGCCAGAGGAAGAATGTCAAGTC -3'
(R):5'- TCAACAAGACCTGCCGGAGTG -3'

Posted On

2021-11-19