Incidental Mutation 'R9047:Trank1'
ID 688128
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms LOC235639, C030048J01Rik, A230061D21Rik, Lba1
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 111140807-111224843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 111191500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 503 (D503A)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: D503A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: D503A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111,221,677 (GRCm39) missense probably damaging 1.00
IGL00467:Trank1 APN 9 111,193,734 (GRCm39) splice site probably benign
IGL00569:Trank1 APN 9 111,174,579 (GRCm39) missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111,178,358 (GRCm39) missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111,195,861 (GRCm39) missense probably damaging 1.00
IGL01134:Trank1 APN 9 111,220,849 (GRCm39) missense probably benign
IGL01154:Trank1 APN 9 111,215,468 (GRCm39) missense probably benign 0.00
IGL01355:Trank1 APN 9 111,194,588 (GRCm39) missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111,193,790 (GRCm39) missense probably damaging 0.99
IGL01410:Trank1 APN 9 111,194,117 (GRCm39) missense probably benign 0.00
IGL01410:Trank1 APN 9 111,194,327 (GRCm39) missense probably benign 0.00
IGL01504:Trank1 APN 9 111,202,612 (GRCm39) missense probably damaging 1.00
IGL01744:Trank1 APN 9 111,178,431 (GRCm39) missense probably damaging 1.00
IGL02043:Trank1 APN 9 111,193,028 (GRCm39) missense probably damaging 0.98
IGL02104:Trank1 APN 9 111,219,780 (GRCm39) missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111,196,344 (GRCm39) missense probably benign 0.43
IGL02581:Trank1 APN 9 111,212,193 (GRCm39) missense probably benign 0.00
IGL02630:Trank1 APN 9 111,202,143 (GRCm39) missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111,193,824 (GRCm39) missense probably damaging 1.00
IGL02897:Trank1 APN 9 111,196,585 (GRCm39) missense probably damaging 0.99
IGL03065:Trank1 APN 9 111,219,361 (GRCm39) missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111,196,475 (GRCm39) missense probably damaging 1.00
IGL03143:Trank1 APN 9 111,195,155 (GRCm39) missense probably damaging 1.00
IGL03323:Trank1 APN 9 111,181,184 (GRCm39) missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111,222,049 (GRCm39) missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111,219,175 (GRCm39) missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111,176,980 (GRCm39) missense probably damaging 1.00
R0035:Trank1 UTSW 9 111,195,844 (GRCm39) missense probably benign 0.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0089:Trank1 UTSW 9 111,221,978 (GRCm39) missense probably benign 0.00
R0207:Trank1 UTSW 9 111,195,321 (GRCm39) missense probably damaging 1.00
R0255:Trank1 UTSW 9 111,195,092 (GRCm39) missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111,222,008 (GRCm39) missense probably damaging 1.00
R0334:Trank1 UTSW 9 111,194,421 (GRCm39) missense probably benign 0.00
R0383:Trank1 UTSW 9 111,220,545 (GRCm39) missense probably benign 0.08
R0421:Trank1 UTSW 9 111,220,907 (GRCm39) missense probably damaging 1.00
R0494:Trank1 UTSW 9 111,220,361 (GRCm39) missense probably benign 0.19
R0518:Trank1 UTSW 9 111,162,876 (GRCm39) missense probably damaging 1.00
R0560:Trank1 UTSW 9 111,220,154 (GRCm39) missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111,219,509 (GRCm39) missense probably damaging 1.00
R0731:Trank1 UTSW 9 111,194,556 (GRCm39) missense probably damaging 1.00
R0761:Trank1 UTSW 9 111,195,681 (GRCm39) missense probably damaging 1.00
R0766:Trank1 UTSW 9 111,176,537 (GRCm39) missense probably benign 0.45
R0827:Trank1 UTSW 9 111,178,485 (GRCm39) unclassified probably benign
R1005:Trank1 UTSW 9 111,162,789 (GRCm39) missense probably benign 0.13
R1108:Trank1 UTSW 9 111,194,375 (GRCm39) missense probably benign 0.00
R1155:Trank1 UTSW 9 111,196,038 (GRCm39) missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111,195,358 (GRCm39) missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111,202,545 (GRCm39) missense probably damaging 1.00
R1751:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1754:Trank1 UTSW 9 111,221,939 (GRCm39) missense probably benign 0.00
R1767:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1768:Trank1 UTSW 9 111,221,995 (GRCm39) missense probably damaging 0.96
R1809:Trank1 UTSW 9 111,221,893 (GRCm39) missense probably benign 0.34
R1912:Trank1 UTSW 9 111,219,777 (GRCm39) missense probably benign 0.00
R1920:Trank1 UTSW 9 111,176,996 (GRCm39) critical splice donor site probably null
R1960:Trank1 UTSW 9 111,220,696 (GRCm39) missense probably damaging 1.00
R1993:Trank1 UTSW 9 111,207,900 (GRCm39) missense probably benign 0.20
R2012:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R2025:Trank1 UTSW 9 111,221,107 (GRCm39) missense probably benign 0.01
R2050:Trank1 UTSW 9 111,193,856 (GRCm39) missense probably damaging 1.00
R2857:Trank1 UTSW 9 111,196,001 (GRCm39) missense probably benign 0.00
R2912:Trank1 UTSW 9 111,221,551 (GRCm39) missense probably damaging 0.98
R2962:Trank1 UTSW 9 111,181,148 (GRCm39) missense probably damaging 1.00
R3030:Trank1 UTSW 9 111,220,598 (GRCm39) missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3822:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3892:Trank1 UTSW 9 111,193,827 (GRCm39) missense probably benign 0.03
R4105:Trank1 UTSW 9 111,181,265 (GRCm39) missense probably damaging 1.00
R4166:Trank1 UTSW 9 111,202,592 (GRCm39) nonsense probably null
R4237:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4239:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4394:Trank1 UTSW 9 111,194,265 (GRCm39) missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111,195,036 (GRCm39) missense probably benign 0.17
R4611:Trank1 UTSW 9 111,191,329 (GRCm39) missense probably damaging 1.00
R4694:Trank1 UTSW 9 111,221,129 (GRCm39) missense probably benign 0.40
R4731:Trank1 UTSW 9 111,219,478 (GRCm39) missense probably damaging 1.00
R4843:Trank1 UTSW 9 111,195,146 (GRCm39) missense probably benign 0.00
R4852:Trank1 UTSW 9 111,220,963 (GRCm39) missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111,194,078 (GRCm39) missense probably benign 0.17
R4868:Trank1 UTSW 9 111,194,709 (GRCm39) missense probably damaging 1.00
R5080:Trank1 UTSW 9 111,218,289 (GRCm39) missense probably damaging 0.99
R5156:Trank1 UTSW 9 111,219,762 (GRCm39) missense probably damaging 1.00
R5174:Trank1 UTSW 9 111,194,627 (GRCm39) missense probably benign 0.00
R5234:Trank1 UTSW 9 111,215,535 (GRCm39) missense probably damaging 1.00
R5386:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R5419:Trank1 UTSW 9 111,220,369 (GRCm39) missense probably damaging 1.00
R5435:Trank1 UTSW 9 111,220,958 (GRCm39) missense probably benign 0.00
R5444:Trank1 UTSW 9 111,222,026 (GRCm39) missense probably benign 0.04
R5543:Trank1 UTSW 9 111,195,180 (GRCm39) missense probably damaging 0.97
R5560:Trank1 UTSW 9 111,219,635 (GRCm39) missense probably damaging 1.00
R5772:Trank1 UTSW 9 111,195,744 (GRCm39) missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111,220,294 (GRCm39) missense probably damaging 1.00
R5843:Trank1 UTSW 9 111,194,928 (GRCm39) missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111,221,604 (GRCm39) missense probably benign
R5878:Trank1 UTSW 9 111,195,753 (GRCm39) missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111,220,784 (GRCm39) missense probably damaging 1.00
R5917:Trank1 UTSW 9 111,191,485 (GRCm39) missense probably benign 0.38
R5954:Trank1 UTSW 9 111,194,201 (GRCm39) missense probably benign 0.13
R6041:Trank1 UTSW 9 111,206,864 (GRCm39) missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111,220,805 (GRCm39) missense probably damaging 1.00
R6165:Trank1 UTSW 9 111,220,940 (GRCm39) missense probably benign 0.00
R6255:Trank1 UTSW 9 111,181,314 (GRCm39) critical splice donor site probably null
R6395:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R6567:Trank1 UTSW 9 111,176,589 (GRCm39) missense probably benign 0.02
R6644:Trank1 UTSW 9 111,193,902 (GRCm39) missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111,194,984 (GRCm39) missense probably damaging 1.00
R6788:Trank1 UTSW 9 111,219,747 (GRCm39) missense probably damaging 1.00
R6831:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R6934:Trank1 UTSW 9 111,202,158 (GRCm39) missense probably damaging 0.99
R7127:Trank1 UTSW 9 111,194,864 (GRCm39) missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111,174,583 (GRCm39) critical splice donor site probably null
R7236:Trank1 UTSW 9 111,202,142 (GRCm39) missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111,196,580 (GRCm39) missense probably damaging 1.00
R7292:Trank1 UTSW 9 111,206,938 (GRCm39) missense probably benign 0.02
R7310:Trank1 UTSW 9 111,196,194 (GRCm39) missense probably damaging 1.00
R7431:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R7448:Trank1 UTSW 9 111,195,417 (GRCm39) missense probably benign 0.01
R7477:Trank1 UTSW 9 111,194,025 (GRCm39) missense probably benign 0.00
R7514:Trank1 UTSW 9 111,193,824 (GRCm39) missense probably damaging 1.00
R7595:Trank1 UTSW 9 111,195,059 (GRCm39) missense probably damaging 1.00
R7637:Trank1 UTSW 9 111,194,364 (GRCm39) missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111,220,753 (GRCm39) missense probably benign
R7737:Trank1 UTSW 9 111,195,080 (GRCm39) nonsense probably null
R7784:Trank1 UTSW 9 111,193,171 (GRCm39) missense probably damaging 1.00
R7884:Trank1 UTSW 9 111,221,584 (GRCm39) missense probably benign
R7912:Trank1 UTSW 9 111,220,596 (GRCm39) missense probably benign 0.04
R7938:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R7979:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R8064:Trank1 UTSW 9 111,181,144 (GRCm39) nonsense probably null
R8100:Trank1 UTSW 9 111,221,861 (GRCm39) missense probably damaging 1.00
R8124:Trank1 UTSW 9 111,207,995 (GRCm39) missense probably benign 0.31
R8198:Trank1 UTSW 9 111,219,880 (GRCm39) missense probably benign 0.09
R8219:Trank1 UTSW 9 111,193,977 (GRCm39) missense probably damaging 1.00
R8223:Trank1 UTSW 9 111,194,957 (GRCm39) missense probably damaging 1.00
R8316:Trank1 UTSW 9 111,178,370 (GRCm39) missense probably benign 0.38
R8347:Trank1 UTSW 9 111,196,317 (GRCm39) missense probably damaging 1.00
R8436:Trank1 UTSW 9 111,220,450 (GRCm39) missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111,219,343 (GRCm39) missense probably benign 0.01
R8682:Trank1 UTSW 9 111,194,412 (GRCm39) missense probably benign 0.01
R8768:Trank1 UTSW 9 111,218,344 (GRCm39) missense probably benign 0.00
R8770:Trank1 UTSW 9 111,219,892 (GRCm39) missense probably benign 0.00
R8829:Trank1 UTSW 9 111,176,591 (GRCm39) missense probably benign
R8838:Trank1 UTSW 9 111,193,973 (GRCm39) missense probably benign 0.03
R8855:Trank1 UTSW 9 111,141,289 (GRCm39) missense unknown
R8929:Trank1 UTSW 9 111,208,003 (GRCm39) missense possibly damaging 0.93
R9090:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9114:Trank1 UTSW 9 111,162,843 (GRCm39) missense probably damaging 1.00
R9133:Trank1 UTSW 9 111,220,770 (GRCm39) missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111,221,579 (GRCm39) missense probably benign 0.00
R9178:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R9271:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9314:Trank1 UTSW 9 111,195,049 (GRCm39) missense probably damaging 1.00
R9373:Trank1 UTSW 9 111,194,259 (GRCm39) missense probably benign 0.25
R9380:Trank1 UTSW 9 111,221,738 (GRCm39) missense probably benign 0.07
R9435:Trank1 UTSW 9 111,193,890 (GRCm39) missense probably benign 0.04
R9501:Trank1 UTSW 9 111,176,943 (GRCm39) missense probably benign 0.00
R9593:Trank1 UTSW 9 111,191,365 (GRCm39) missense probably benign 0.30
R9601:Trank1 UTSW 9 111,202,193 (GRCm39) missense probably benign 0.18
R9729:Trank1 UTSW 9 111,220,537 (GRCm39) missense probably damaging 1.00
X0064:Trank1 UTSW 9 111,172,304 (GRCm39) missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111,193,778 (GRCm39) missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111,221,938 (GRCm39) missense possibly damaging 0.47
Z1177:Trank1 UTSW 9 111,196,445 (GRCm39) missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111,140,970 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGAAATTCCTGCTGGCCTG -3'
(R):5'- TGGGATTCACAAGGATACAGC -3'

Sequencing Primer
(F):5'- CTGGTTTGTGACGTTAACCGAGAC -3'
(R):5'- CCTTCACTGTTTCACGGGGAG -3'
Posted On 2021-11-19