Incidental Mutation 'R9047:Enpp3'
ID 688129
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24674172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 376 (D376G)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020169
AA Change: D376G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D376G

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCTCGGAATGTGGTAGC -3'
(R):5'- ATGAACATGGCTCTTCTCATCCAC -3'

Sequencing Primer
(F):5'- CGGAATGTGGTAGCATCGGC -3'
(R):5'- CATCCACTACCTCCATTTTCAAG -3'
Posted On 2021-11-19