Mutagenetix > Incidental Mutation

Incidental Mutation 'R9047:Enpp3'

688129

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R9047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24798274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 376 (D376G)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020169
AA Change: D376G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D376G

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,939,093	S156T	probably damaging	Het
4930522L14Rik	A	G	5: 109,737,554	L146P		Het
Adra1a	T	A	14: 66,638,185	M203K	probably damaging	Het
Adtrp	G	A	13: 41,816,160	T89I	possibly damaging	Het
Akt3	G	T	1: 177,059,389	T298K	probably damaging	Het
Aldh4a1	G	T	4: 139,623,200		probably benign	Het
Aplf	T	C	6: 87,663,797	T77A	possibly damaging	Het
Arid4b	T	A	13: 14,181,230	W618R	probably damaging	Het
Asxl3	C	A	18: 22,452,408	P130Q	probably damaging	Het
Asxl3	A	G	18: 22,452,414	K132R	probably damaging	Het
Atp11a	T	C	8: 12,828,483	M353T	probably damaging	Het
Atp11b	A	G	3: 35,806,889	D375G	probably damaging	Het
BC052040	A	G	2: 115,777,023	T286A	probably benign	Het
Cage1	C	T	13: 38,017,362	A656T	possibly damaging	Het
Casz1	C	T	4: 148,939,040	P801S	probably damaging	Het
Ccdc130	C	T	8: 84,263,898	R35Q	probably damaging	Het
Ccdc144b	A	G	3: 36,032,884	I187T	probably benign	Het
Cdc14b	A	T	13: 64,220,944		probably benign	Het
Cox6b2	A	G	7: 4,752,087	F63L	probably benign	Het
Cramp1l	A	C	17: 24,979,629	V773G	possibly damaging	Het
Cul7	A	G	17: 46,654,522	E542G	probably benign	Het
Cyp2c55	T	C	19: 39,031,346	Y243H	possibly damaging	Het
Dnah9	C	A	11: 66,072,099	D1797Y	possibly damaging	Het
Dpep2	C	A	8: 105,989,312	A298S		Het
Dvl3	G	A	16: 20,524,076		probably null	Het
Ffar4	T	C	19: 38,113,784	I289T	possibly damaging	Het
Gm3417	A	G	17: 14,967,680	Y111H	probably damaging	Het
Gm5565	T	C	5: 146,158,039	Y299C	probably damaging	Het
Gm8765	C	T	13: 50,702,092	R589*	probably null	Het
Gpat3	A	T	5: 100,846,922	M39L	probably benign	Het
Gpr153	T	C	4: 152,280,207	L240P	probably damaging	Het
Gpr182	T	C	10: 127,750,648	I145V	probably benign	Het
H2-Q4	A	T	17: 35,379,993	T80S	possibly damaging	Het
Hnf1a	T	A	5: 114,950,823	T545S	probably benign	Het
Kif5b	A	C	18: 6,208,261	F946V	probably benign	Het
Krtap16-1	C	T	11: 99,986,341	C79Y	probably damaging	Het
Lama2	A	G	10: 27,006,701	V2622A	possibly damaging	Het
Lrrc37a	T	A	11: 103,500,549	Q1350L	probably damaging	Het
Map2k2	G	A	10: 81,119,664	V294I	probably benign	Het
Mtus1	G	A	8: 41,083,723	H319Y	possibly damaging	Het
Ncdn	T	C	4: 126,750,828	D67G	possibly damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp9b	A	G	7: 20,023,476	I213V	possibly damaging	Het
Nyap2	G	A	1: 81,298,088	R649H	possibly damaging	Het
Olfr1165-ps	T	G	2: 88,101,072	D305A	unknown	Het
Olfr1200	C	A	2: 88,767,955	R120L	probably damaging	Het
Olfr304	A	G	7: 86,386,040	S207P	probably benign	Het
Pi4kb	T	A	3: 94,993,117	L354Q	probably damaging	Het
Plekhh2	T	C	17: 84,590,762	S944P	probably damaging	Het
Podn	C	T	4: 108,021,546	V375M	probably damaging	Het
Pramef8	C	A	4: 143,419,103	Q381K	possibly damaging	Het
Psmb2	T	A	4: 126,706,102	H110Q	probably benign	Het
Rasip1	A	G	7: 45,632,642	E523G	possibly damaging	Het
Ripor1	T	G	8: 105,616,151	C219G	probably damaging	Het
Rps6ka2	G	C	17: 7,300,279	V714L	probably damaging	Het
Sass6	G	T	3: 116,613,998	L254F	probably damaging	Het
Scarf2	G	A	16: 17,806,406	G525E	probably damaging	Het
Sh3d21	T	A	4: 126,152,338		probably benign	Het
Sh3tc1	C	A	5: 35,706,483	A787S	probably benign	Het
Skint5	T	A	4: 113,655,722	N871I	unknown	Het
Slc48a1	T	G	15: 97,789,952	D62E	probably damaging	Het
Slc6a21	G	A	7: 45,286,974	M157I		Het
Slurp2	T	C	15: 74,743,112	D60G	probably benign	Het
Sparcl1	G	T	5: 104,093,113	N148K	possibly damaging	Het
Spsb2	T	A	6: 124,810,013	N236K	probably benign	Het
Sptb	G	T	12: 76,632,534		probably benign	Het
Ssc4d	A	T	5: 135,961,176	C41S	probably damaging	Het
Tecta	A	T	9: 42,375,079	D760E	probably benign	Het
Tesmin	G	T	19: 3,389,431		probably benign	Het
Tiam1	A	C	16: 89,804,888		probably benign	Het
Tldc1	T	C	8: 119,762,311	N411S	probably benign	Het
Tnrc6a	T	C	7: 123,179,723	L1219S	probably damaging	Het
Tram1	T	G	1: 13,569,606	I306L	probably benign	Het
Trank1	A	C	9: 111,362,432	D503A	probably damaging	Het
Ttc21b	T	C	2: 66,201,252	H1044R		Het
Ubac2	T	C	14: 121,908,214	F95L	probably benign	Het
Vmn2r91	A	T	17: 18,106,034	M194L	probably benign	Het
Zdhhc1	G	T	8: 105,478,901	H90Q	probably damaging	Het
Zfp169	C	T	13: 48,498,816	V42I	probably damaging	Het
Zfp81	A	G	17: 33,334,413	C476R	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTCTCGGAATGTGGTAGC -3'
(R):5'- ATGAACATGGCTCTTCTCATCCAC -3'

Sequencing Primer
(F):5'- CGGAATGTGGTAGCATCGGC -3'
(R):5'- CATCCACTACCTCCATTTTCAAG -3'

Posted On

2021-11-19