Incidental Mutation 'R9047:Lrrc37a'
ID 688135
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103391375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1350 (Q1350L)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000153273
AA Change: Q1350L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Q1350L

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cul7 A G 17: 46,965,448 (GRCm39) E542G probably benign Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103,390,616 (GRCm39) missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1982:Lrrc37a UTSW 11 103,389,792 (GRCm39) missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103,391,784 (GRCm39) missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103,395,126 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9194:Lrrc37a UTSW 11 103,391,676 (GRCm39) missense probably benign 0.03
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCTAGATCCACAGGCTGAAC -3'
(R):5'- CCTATGTAGCTGAAGTCACAGTTC -3'

Sequencing Primer
(F):5'- TGAACTGCAGCTTCACTTAGG -3'
(R):5'- GCTGAAGTCACAGTTCAACCTTTGG -3'
Posted On 2021-11-19