Mutagenetix > Incidental Mutation

Incidental Mutation 'R9047:Arid4b'

688136

Institutional Source

Beutler Lab

Gene Symbol

Arid4b

Ensembl Gene

ENSMUSG00000039219

Gene Name

AT rich interactive domain 4B (RBP1-like)

Synonyms

6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14063232-14199603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14181230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 618 (W618R)

Ref Sequence

ENSEMBL: ENSMUSP00000106163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110534] [ENSMUST00000110536]

AlphaFold

A2CG63

Predicted Effect

probably damaging
Transcript: ENSMUST00000039538
AA Change: W531R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: W531R

Domain	Start	End	E-Value	Type
TUDOR	58	114	4.13e-9	SMART
low complexity region	151	165	N/A	INTRINSIC
Pfam:RBB1NT	166	264	3.4e-46	PFAM
ARID	303	394	3.81e-34	SMART
BRIGHT	307	399	4.99e-36	SMART
low complexity region	421	441	N/A	INTRINSIC
low complexity region	543	562	N/A	INTRINSIC
low complexity region	621	635	N/A	INTRINSIC
low complexity region	704	713	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	769	785	N/A	INTRINSIC
low complexity region	937	949	N/A	INTRINSIC
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1002	1016	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
coiled coil region	1145	1182	N/A	INTRINSIC
low complexity region	1186	1204	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110534
AA Change: W618R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: W618R

Domain	Start	End	E-Value	Type
TUDOR	58	114	4.13e-9	SMART
low complexity region	151	165	N/A	INTRINSIC
Pfam:RBB1NT	168	263	4.1e-39	PFAM
ARID	303	394	3.81e-34	SMART
BRIGHT	307	399	4.99e-36	SMART
low complexity region	421	441	N/A	INTRINSIC
TUDOR	567	632	1.91e1	SMART
CHROMO	585	640	1.29e-1	SMART
low complexity region	708	722	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
low complexity region	802	815	N/A	INTRINSIC
low complexity region	856	872	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
low complexity region	1041	1051	N/A	INTRINSIC
low complexity region	1089	1103	N/A	INTRINSIC
low complexity region	1141	1155	N/A	INTRINSIC
coiled coil region	1232	1269	N/A	INTRINSIC
low complexity region	1273	1291	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110536
AA Change: W531R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: W531R

Domain	Start	End	E-Value	Type
TUDOR	58	114	4.13e-9	SMART
low complexity region	151	165	N/A	INTRINSIC
Pfam:RBB1NT	166	264	3.4e-46	PFAM
ARID	303	394	3.81e-34	SMART
BRIGHT	307	399	4.99e-36	SMART
low complexity region	421	441	N/A	INTRINSIC
low complexity region	543	562	N/A	INTRINSIC
low complexity region	621	635	N/A	INTRINSIC
low complexity region	704	713	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	769	785	N/A	INTRINSIC
low complexity region	937	949	N/A	INTRINSIC
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1002	1016	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
coiled coil region	1145	1182	N/A	INTRINSIC
low complexity region	1186	1204	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,939,093	S156T	probably damaging	Het
4930522L14Rik	A	G	5: 109,737,554	L146P		Het
Adra1a	T	A	14: 66,638,185	M203K	probably damaging	Het
Adtrp	G	A	13: 41,816,160	T89I	possibly damaging	Het
Akt3	G	T	1: 177,059,389	T298K	probably damaging	Het
Aldh4a1	G	T	4: 139,623,200		probably benign	Het
Aplf	T	C	6: 87,663,797	T77A	possibly damaging	Het
Asxl3	C	A	18: 22,452,408	P130Q	probably damaging	Het
Asxl3	A	G	18: 22,452,414	K132R	probably damaging	Het
Atp11a	T	C	8: 12,828,483	M353T	probably damaging	Het
Atp11b	A	G	3: 35,806,889	D375G	probably damaging	Het
BC052040	A	G	2: 115,777,023	T286A	probably benign	Het
Cage1	C	T	13: 38,017,362	A656T	possibly damaging	Het
Casz1	C	T	4: 148,939,040	P801S	probably damaging	Het
Ccdc130	C	T	8: 84,263,898	R35Q	probably damaging	Het
Ccdc144b	A	G	3: 36,032,884	I187T	probably benign	Het
Cdc14b	A	T	13: 64,220,944		probably benign	Het
Cox6b2	A	G	7: 4,752,087	F63L	probably benign	Het
Cramp1l	A	C	17: 24,979,629	V773G	possibly damaging	Het
Cul7	A	G	17: 46,654,522	E542G	probably benign	Het
Cyp2c55	T	C	19: 39,031,346	Y243H	possibly damaging	Het
Dnah9	C	A	11: 66,072,099	D1797Y	possibly damaging	Het
Dpep2	C	A	8: 105,989,312	A298S		Het
Dvl3	G	A	16: 20,524,076		probably null	Het
Enpp3	T	C	10: 24,798,274	D376G	possibly damaging	Het
Ffar4	T	C	19: 38,113,784	I289T	possibly damaging	Het
Gm3417	A	G	17: 14,967,680	Y111H	probably damaging	Het
Gm5565	T	C	5: 146,158,039	Y299C	probably damaging	Het
Gm8765	C	T	13: 50,702,092	R589*	probably null	Het
Gpat3	A	T	5: 100,846,922	M39L	probably benign	Het
Gpr153	T	C	4: 152,280,207	L240P	probably damaging	Het
Gpr182	T	C	10: 127,750,648	I145V	probably benign	Het
H2-Q4	A	T	17: 35,379,993	T80S	possibly damaging	Het
Hnf1a	T	A	5: 114,950,823	T545S	probably benign	Het
Kif5b	A	C	18: 6,208,261	F946V	probably benign	Het
Krtap16-1	C	T	11: 99,986,341	C79Y	probably damaging	Het
Lama2	A	G	10: 27,006,701	V2622A	possibly damaging	Het
Lrrc37a	T	A	11: 103,500,549	Q1350L	probably damaging	Het
Map2k2	G	A	10: 81,119,664	V294I	probably benign	Het
Mtus1	G	A	8: 41,083,723	H319Y	possibly damaging	Het
Ncdn	T	C	4: 126,750,828	D67G	possibly damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp9b	A	G	7: 20,023,476	I213V	possibly damaging	Het
Nyap2	G	A	1: 81,298,088	R649H	possibly damaging	Het
Olfr1165-ps	T	G	2: 88,101,072	D305A	unknown	Het
Olfr1200	C	A	2: 88,767,955	R120L	probably damaging	Het
Olfr304	A	G	7: 86,386,040	S207P	probably benign	Het
Pi4kb	T	A	3: 94,993,117	L354Q	probably damaging	Het
Plekhh2	T	C	17: 84,590,762	S944P	probably damaging	Het
Podn	C	T	4: 108,021,546	V375M	probably damaging	Het
Pramef8	C	A	4: 143,419,103	Q381K	possibly damaging	Het
Psmb2	T	A	4: 126,706,102	H110Q	probably benign	Het
Rasip1	A	G	7: 45,632,642	E523G	possibly damaging	Het
Ripor1	T	G	8: 105,616,151	C219G	probably damaging	Het
Rps6ka2	G	C	17: 7,300,279	V714L	probably damaging	Het
Sass6	G	T	3: 116,613,998	L254F	probably damaging	Het
Scarf2	G	A	16: 17,806,406	G525E	probably damaging	Het
Sh3d21	T	A	4: 126,152,338		probably benign	Het
Sh3tc1	C	A	5: 35,706,483	A787S	probably benign	Het
Skint5	T	A	4: 113,655,722	N871I	unknown	Het
Slc48a1	T	G	15: 97,789,952	D62E	probably damaging	Het
Slc6a21	G	A	7: 45,286,974	M157I		Het
Slurp2	T	C	15: 74,743,112	D60G	probably benign	Het
Sparcl1	G	T	5: 104,093,113	N148K	possibly damaging	Het
Spsb2	T	A	6: 124,810,013	N236K	probably benign	Het
Sptb	G	T	12: 76,632,534		probably benign	Het
Ssc4d	A	T	5: 135,961,176	C41S	probably damaging	Het
Tecta	A	T	9: 42,375,079	D760E	probably benign	Het
Tesmin	G	T	19: 3,389,431		probably benign	Het
Tiam1	A	C	16: 89,804,888		probably benign	Het
Tldc1	T	C	8: 119,762,311	N411S	probably benign	Het
Tnrc6a	T	C	7: 123,179,723	L1219S	probably damaging	Het
Tram1	T	G	1: 13,569,606	I306L	probably benign	Het
Trank1	A	C	9: 111,362,432	D503A	probably damaging	Het
Ttc21b	T	C	2: 66,201,252	H1044R		Het
Ubac2	T	C	14: 121,908,214	F95L	probably benign	Het
Vmn2r91	A	T	17: 18,106,034	M194L	probably benign	Het
Zdhhc1	G	T	8: 105,478,901	H90Q	probably damaging	Het
Zfp169	C	T	13: 48,498,816	V42I	probably damaging	Het
Zfp81	A	G	17: 33,334,413	C476R	probably damaging	Het

Other mutations in Arid4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Arid4b	APN	13	14191134	unclassified	probably benign
IGL00581:Arid4b	APN	13	14160195	missense	probably damaging	1.00
IGL00808:Arid4b	APN	13	14136261	critical splice donor site	probably null
IGL01150:Arid4b	APN	13	14195374	nonsense	probably null
IGL01570:Arid4b	APN	13	14186809	unclassified	probably benign
IGL01942:Arid4b	APN	13	14136164	intron	probably benign
IGL02031:Arid4b	APN	13	14153412	splice site	probably benign
IGL02183:Arid4b	APN	13	14169990	missense	possibly damaging	0.68
R0096:Arid4b	UTSW	13	14129194	missense	probably benign	0.08
R0096:Arid4b	UTSW	13	14129194	missense	probably benign	0.08
R0514:Arid4b	UTSW	13	14184317	missense	probably damaging	1.00
R0694:Arid4b	UTSW	13	14187834	missense	probably damaging	0.96
R0746:Arid4b	UTSW	13	14143038	missense	probably benign	0.01
R1624:Arid4b	UTSW	13	14184394	missense	probably damaging	0.99
R1625:Arid4b	UTSW	13	14187114	missense	probably damaging	0.99
R1812:Arid4b	UTSW	13	14195429	missense	probably damaging	1.00
R1891:Arid4b	UTSW	13	14136236	missense	possibly damaging	0.94
R1990:Arid4b	UTSW	13	14132436	missense	probably damaging	0.99
R2051:Arid4b	UTSW	13	14187645	missense	probably damaging	0.98
R2060:Arid4b	UTSW	13	14195452	missense	probably damaging	1.00
R2344:Arid4b	UTSW	13	14153490	missense	probably benign	0.26
R3605:Arid4b	UTSW	13	14120241	missense	probably damaging	1.00
R3606:Arid4b	UTSW	13	14120241	missense	probably damaging	1.00
R3844:Arid4b	UTSW	13	14187060	missense	probably damaging	0.99
R3909:Arid4b	UTSW	13	14132484	missense	probably damaging	1.00
R3938:Arid4b	UTSW	13	14186928	missense	probably benign	0.34
R4394:Arid4b	UTSW	13	14154972	splice site	probably null
R4466:Arid4b	UTSW	13	14132510	missense	probably damaging	1.00
R4530:Arid4b	UTSW	13	14126455	missense	probably damaging	0.98
R4537:Arid4b	UTSW	13	14120161	nonsense	probably null
R4829:Arid4b	UTSW	13	14184438	missense	probably benign	0.23
R4930:Arid4b	UTSW	13	14187477	missense	probably damaging	0.99
R4972:Arid4b	UTSW	13	14160272	missense	probably benign	0.07
R5119:Arid4b	UTSW	13	14164281	missense	probably benign	0.15
R5236:Arid4b	UTSW	13	14126449	critical splice acceptor site	probably null
R5304:Arid4b	UTSW	13	14186929	missense	probably benign	0.34
R5439:Arid4b	UTSW	13	14187696	missense	probably damaging	0.99
R5734:Arid4b	UTSW	13	14160271	missense	probably benign	0.09
R5950:Arid4b	UTSW	13	14191264	splice site	probably benign
R5951:Arid4b	UTSW	13	14143063	missense	possibly damaging	0.80
R6645:Arid4b	UTSW	13	14120152	missense	probably damaging	1.00
R6765:Arid4b	UTSW	13	14187315	missense	possibly damaging	0.84
R6804:Arid4b	UTSW	13	14129207	missense	probably benign	0.44
R7342:Arid4b	UTSW	13	14136219	missense	probably benign	0.03
R7354:Arid4b	UTSW	13	14164870	missense	probably benign	0.19
R7426:Arid4b	UTSW	13	14181306	critical splice donor site	probably null
R7863:Arid4b	UTSW	13	14164149	missense	probably benign	0.01
R8070:Arid4b	UTSW	13	14136259	missense	probably benign	0.32
R8076:Arid4b	UTSW	13	14186950	missense	probably benign	0.01
R8239:Arid4b	UTSW	13	14170009	missense	probably benign
R8303:Arid4b	UTSW	13	14120223	missense	probably damaging	1.00
R9799:Arid4b	UTSW	13	14184382	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATTCCTACCCATTGCTTAAACGC -3'
(R):5'- GCCCACACATGTATTTTAATTGCC -3'

Sequencing Primer
(F):5'- GGTAGTGACCATGGGACAGTC -3'
(R):5'- CACACATGTATTTTAATTGCCTTGGG -3'

Posted On

2021-11-19