Incidental Mutation 'R9047:Zfp169'
ID 688139
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48498816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 42 (V42I)
Ref Sequence ENSEMBL: ENSMUSP00000134793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: V42I
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167682
AA Change: V42I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176176
AA Change: V42I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176949
AA Change: V42I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176996
AA Change: V42I
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: V42I
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: V42I

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,939,093 S156T probably damaging Het
4930522L14Rik A G 5: 109,737,554 L146P Het
Adra1a T A 14: 66,638,185 M203K probably damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Akt3 G T 1: 177,059,389 T298K probably damaging Het
Aldh4a1 G T 4: 139,623,200 probably benign Het
Aplf T C 6: 87,663,797 T77A possibly damaging Het
Arid4b T A 13: 14,181,230 W618R probably damaging Het
Asxl3 C A 18: 22,452,408 P130Q probably damaging Het
Asxl3 A G 18: 22,452,414 K132R probably damaging Het
Atp11a T C 8: 12,828,483 M353T probably damaging Het
Atp11b A G 3: 35,806,889 D375G probably damaging Het
BC052040 A G 2: 115,777,023 T286A probably benign Het
Cage1 C T 13: 38,017,362 A656T possibly damaging Het
Casz1 C T 4: 148,939,040 P801S probably damaging Het
Ccdc130 C T 8: 84,263,898 R35Q probably damaging Het
Ccdc144b A G 3: 36,032,884 I187T probably benign Het
Cdc14b A T 13: 64,220,944 probably benign Het
Cox6b2 A G 7: 4,752,087 F63L probably benign Het
Cramp1l A C 17: 24,979,629 V773G possibly damaging Het
Cul7 A G 17: 46,654,522 E542G probably benign Het
Cyp2c55 T C 19: 39,031,346 Y243H possibly damaging Het
Dnah9 C A 11: 66,072,099 D1797Y possibly damaging Het
Dpep2 C A 8: 105,989,312 A298S Het
Dvl3 G A 16: 20,524,076 probably null Het
Enpp3 T C 10: 24,798,274 D376G possibly damaging Het
Ffar4 T C 19: 38,113,784 I289T possibly damaging Het
Gm3417 A G 17: 14,967,680 Y111H probably damaging Het
Gm5565 T C 5: 146,158,039 Y299C probably damaging Het
Gm8765 C T 13: 50,702,092 R589* probably null Het
Gpat3 A T 5: 100,846,922 M39L probably benign Het
Gpr153 T C 4: 152,280,207 L240P probably damaging Het
Gpr182 T C 10: 127,750,648 I145V probably benign Het
H2-Q4 A T 17: 35,379,993 T80S possibly damaging Het
Hnf1a T A 5: 114,950,823 T545S probably benign Het
Kif5b A C 18: 6,208,261 F946V probably benign Het
Krtap16-1 C T 11: 99,986,341 C79Y probably damaging Het
Lama2 A G 10: 27,006,701 V2622A possibly damaging Het
Lrrc37a T A 11: 103,500,549 Q1350L probably damaging Het
Map2k2 G A 10: 81,119,664 V294I probably benign Het
Mtus1 G A 8: 41,083,723 H319Y possibly damaging Het
Ncdn T C 4: 126,750,828 D67G possibly damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nlrp9b A G 7: 20,023,476 I213V possibly damaging Het
Nyap2 G A 1: 81,298,088 R649H possibly damaging Het
Olfr1165-ps T G 2: 88,101,072 D305A unknown Het
Olfr1200 C A 2: 88,767,955 R120L probably damaging Het
Olfr304 A G 7: 86,386,040 S207P probably benign Het
Pi4kb T A 3: 94,993,117 L354Q probably damaging Het
Plekhh2 T C 17: 84,590,762 S944P probably damaging Het
Podn C T 4: 108,021,546 V375M probably damaging Het
Pramef8 C A 4: 143,419,103 Q381K possibly damaging Het
Psmb2 T A 4: 126,706,102 H110Q probably benign Het
Rasip1 A G 7: 45,632,642 E523G possibly damaging Het
Ripor1 T G 8: 105,616,151 C219G probably damaging Het
Rps6ka2 G C 17: 7,300,279 V714L probably damaging Het
Sass6 G T 3: 116,613,998 L254F probably damaging Het
Scarf2 G A 16: 17,806,406 G525E probably damaging Het
Sh3d21 T A 4: 126,152,338 probably benign Het
Sh3tc1 C A 5: 35,706,483 A787S probably benign Het
Skint5 T A 4: 113,655,722 N871I unknown Het
Slc48a1 T G 15: 97,789,952 D62E probably damaging Het
Slc6a21 G A 7: 45,286,974 M157I Het
Slurp2 T C 15: 74,743,112 D60G probably benign Het
Sparcl1 G T 5: 104,093,113 N148K possibly damaging Het
Spsb2 T A 6: 124,810,013 N236K probably benign Het
Sptb G T 12: 76,632,534 probably benign Het
Ssc4d A T 5: 135,961,176 C41S probably damaging Het
Tecta A T 9: 42,375,079 D760E probably benign Het
Tesmin G T 19: 3,389,431 probably benign Het
Tiam1 A C 16: 89,804,888 probably benign Het
Tldc1 T C 8: 119,762,311 N411S probably benign Het
Tnrc6a T C 7: 123,179,723 L1219S probably damaging Het
Tram1 T G 1: 13,569,606 I306L probably benign Het
Trank1 A C 9: 111,362,432 D503A probably damaging Het
Ttc21b T C 2: 66,201,252 H1044R Het
Ubac2 T C 14: 121,908,214 F95L probably benign Het
Vmn2r91 A T 17: 18,106,034 M194L probably benign Het
Zdhhc1 G T 8: 105,478,901 H90Q probably damaging Het
Zfp81 A G 17: 33,334,413 C476R probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R8322:Zfp169 UTSW 13 48491099 missense unknown
R9124:Zfp169 UTSW 13 48491081 missense unknown
R9126:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAAGCAGGGTCAATCGCC -3'
(R):5'- CTTGGTTCCGGATAGTGACAGG -3'

Sequencing Primer
(F):5'- TTGTCAGTCACTGCATGCACAAG -3'
(R):5'- CCGGATAGTGACAGGCTGGTTAC -3'
Posted On 2021-11-19