Incidental Mutation 'R9047:Cul7'
ID 688153
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Name cullin 7
Synonyms p185, p193, C230011P08Rik, 2510004L20Rik
MMRRC Submission 068873-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9047 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 46961264-46975290 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46965448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 542 (E542G)
Ref Sequence ENSEMBL: ENSMUSP00000049128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002844] [ENSMUST00000043464] [ENSMUST00000113429] [ENSMUST00000113430] [ENSMUST00000133393] [ENSMUST00000145567]
AlphaFold Q8VE73
Predicted Effect probably benign
Transcript: ENSMUST00000002844
SMART Domains Protein: ENSMUSP00000002844
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Ribosomal_L2 84 166 3.44e-29 SMART
Ribosomal_L2_C 177 298 1.32e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043464
AA Change: E542G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: E542G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113429
SMART Domains Protein: ENSMUSP00000109056
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 84 166 1.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113430
SMART Domains Protein: ENSMUSP00000109057
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 82 164 1.6e-31 PFAM
Pfam:Ribosomal_L2_C 175 279 5.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133393
AA Change: E244G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545
AA Change: E244G

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
AA Change: E542G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545
AA Change: E542G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,848 (GRCm39) S156T probably damaging Het
4930522L14Rik A G 5: 109,885,420 (GRCm39) L146P Het
Adra1a T A 14: 66,875,634 (GRCm39) M203K probably damaging Het
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Akt3 G T 1: 176,886,955 (GRCm39) T298K probably damaging Het
Aldh4a1 G T 4: 139,350,511 (GRCm39) probably benign Het
Aplf T C 6: 87,640,779 (GRCm39) T77A possibly damaging Het
Arid4b T A 13: 14,355,815 (GRCm39) W618R probably damaging Het
Asxl3 C A 18: 22,585,465 (GRCm39) P130Q probably damaging Het
Asxl3 A G 18: 22,585,471 (GRCm39) K132R probably damaging Het
Atp11a T C 8: 12,878,483 (GRCm39) M353T probably damaging Het
Atp11b A G 3: 35,861,038 (GRCm39) D375G probably damaging Het
Cage1 C T 13: 38,201,338 (GRCm39) A656T possibly damaging Het
Casz1 C T 4: 149,023,497 (GRCm39) P801S probably damaging Het
Cdc14b A T 13: 64,368,758 (GRCm39) probably benign Het
Cdin1 A G 2: 115,607,504 (GRCm39) T286A probably benign Het
Cox6b2 A G 7: 4,755,086 (GRCm39) F63L probably benign Het
Cramp1 A C 17: 25,198,603 (GRCm39) V773G possibly damaging Het
Cyp2c55 T C 19: 39,019,790 (GRCm39) Y243H possibly damaging Het
Dnah9 C A 11: 65,962,925 (GRCm39) D1797Y possibly damaging Het
Dpep2 C A 8: 106,715,944 (GRCm39) A298S Het
Dvl3 G A 16: 20,342,826 (GRCm39) probably null Het
Dynlt2a3 A G 17: 15,187,942 (GRCm39) Y111H probably damaging Het
Enpp3 T C 10: 24,674,172 (GRCm39) D376G possibly damaging Het
Ffar4 T C 19: 38,102,232 (GRCm39) I289T possibly damaging Het
Gm5565 T C 5: 146,094,849 (GRCm39) Y299C probably damaging Het
Gm57858 A G 3: 36,087,033 (GRCm39) I187T probably benign Het
Gpat3 A T 5: 100,994,788 (GRCm39) M39L probably benign Het
Gpr153 T C 4: 152,364,664 (GRCm39) L240P probably damaging Het
Gpr182 T C 10: 127,586,517 (GRCm39) I145V probably benign Het
H2-Q4 A T 17: 35,598,969 (GRCm39) T80S possibly damaging Het
Hnf1a T A 5: 115,088,882 (GRCm39) T545S probably benign Het
Kif5b A C 18: 6,208,261 (GRCm39) F946V probably benign Het
Krtap16-1 C T 11: 99,877,167 (GRCm39) C79Y probably damaging Het
Lama2 A G 10: 26,882,697 (GRCm39) V2622A possibly damaging Het
Lrrc37a T A 11: 103,391,375 (GRCm39) Q1350L probably damaging Het
Map2k2 G A 10: 80,955,498 (GRCm39) V294I probably benign Het
Meak7 T C 8: 120,489,050 (GRCm39) N411S probably benign Het
Mtus1 G A 8: 41,536,760 (GRCm39) H319Y possibly damaging Het
Ncdn T C 4: 126,644,621 (GRCm39) D67G possibly damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp9b A G 7: 19,757,401 (GRCm39) I213V possibly damaging Het
Nyap2 G A 1: 81,275,803 (GRCm39) R649H possibly damaging Het
Or14a258 A G 7: 86,035,248 (GRCm39) S207P probably benign Het
Or4a67 C A 2: 88,598,299 (GRCm39) R120L probably damaging Het
Or5d20-ps1 T G 2: 87,931,416 (GRCm39) D305A unknown Het
Pi4kb T A 3: 94,900,428 (GRCm39) L354Q probably damaging Het
Plekhh2 T C 17: 84,898,190 (GRCm39) S944P probably damaging Het
Podn C T 4: 107,878,743 (GRCm39) V375M probably damaging Het
Pramel12 C A 4: 143,145,673 (GRCm39) Q381K possibly damaging Het
Psmb2 T A 4: 126,599,895 (GRCm39) H110Q probably benign Het
Rasip1 A G 7: 45,282,066 (GRCm39) E523G possibly damaging Het
Ripor1 T G 8: 106,342,783 (GRCm39) C219G probably damaging Het
Rps6ka2 G C 17: 7,567,678 (GRCm39) V714L probably damaging Het
Sass6 G T 3: 116,407,647 (GRCm39) L254F probably damaging Het
Scarf2 G A 16: 17,624,270 (GRCm39) G525E probably damaging Het
Sh3d21 T A 4: 126,046,131 (GRCm39) probably benign Het
Sh3tc1 C A 5: 35,863,827 (GRCm39) A787S probably benign Het
Skint5 T A 4: 113,512,919 (GRCm39) N871I unknown Het
Slc48a1 T G 15: 97,687,833 (GRCm39) D62E probably damaging Het
Slc6a21 G A 7: 44,936,398 (GRCm39) M157I Het
Slurp2 T C 15: 74,614,961 (GRCm39) D60G probably benign Het
Sparcl1 G T 5: 104,240,979 (GRCm39) N148K possibly damaging Het
Spata31e4 C T 13: 50,856,128 (GRCm39) R589* probably null Het
Spsb2 T A 6: 124,786,976 (GRCm39) N236K probably benign Het
Sptb G T 12: 76,679,308 (GRCm39) probably benign Het
Ssc4d A T 5: 135,990,030 (GRCm39) C41S probably damaging Het
Tecta A T 9: 42,286,375 (GRCm39) D760E probably benign Het
Tesmin G T 19: 3,439,431 (GRCm39) probably benign Het
Tiam1 A C 16: 89,601,776 (GRCm39) probably benign Het
Tnrc6a T C 7: 122,778,946 (GRCm39) L1219S probably damaging Het
Tram1 T G 1: 13,639,830 (GRCm39) I306L probably benign Het
Trank1 A C 9: 111,191,500 (GRCm39) D503A probably damaging Het
Ttc21b T C 2: 66,031,596 (GRCm39) H1044R Het
Ubac2 T C 14: 122,145,626 (GRCm39) F95L probably benign Het
Vmn2r91 A T 17: 18,326,296 (GRCm39) M194L probably benign Het
Yju2b C T 8: 84,990,527 (GRCm39) R35Q probably damaging Het
Zdhhc1 G T 8: 106,205,533 (GRCm39) H90Q probably damaging Het
Zfp169 C T 13: 48,652,292 (GRCm39) V42I probably damaging Het
Zfp81 A G 17: 33,553,387 (GRCm39) C476R probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46,963,434 (GRCm39) missense probably damaging 1.00
IGL01288:Cul7 APN 17 46,968,733 (GRCm39) splice site probably benign
IGL01669:Cul7 APN 17 46,969,641 (GRCm39) missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46,971,173 (GRCm39) splice site probably benign
PIT4453001:Cul7 UTSW 17 46,962,746 (GRCm39) missense probably damaging 0.99
R0083:Cul7 UTSW 17 46,966,482 (GRCm39) missense probably benign 0.00
R0121:Cul7 UTSW 17 46,974,299 (GRCm39) missense probably damaging 1.00
R0157:Cul7 UTSW 17 46,964,761 (GRCm39) missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46,965,521 (GRCm39) missense probably benign 0.00
R0358:Cul7 UTSW 17 46,974,670 (GRCm39) critical splice donor site probably null
R0544:Cul7 UTSW 17 46,974,470 (GRCm39) missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46,962,929 (GRCm39) missense probably damaging 0.98
R0677:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R0696:Cul7 UTSW 17 46,970,534 (GRCm39) missense probably damaging 1.00
R0702:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R0735:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R0893:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R0900:Cul7 UTSW 17 46,969,263 (GRCm39) missense probably benign 0.36
R0975:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R0976:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1014:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1016:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1104:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1162:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1378:Cul7 UTSW 17 46,973,052 (GRCm39) missense probably damaging 0.99
R1479:Cul7 UTSW 17 46,962,673 (GRCm39) missense probably damaging 1.00
R1498:Cul7 UTSW 17 46,966,636 (GRCm39) missense probably benign 0.01
R1521:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1542:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1545:Cul7 UTSW 17 46,962,479 (GRCm39) missense probably damaging 1.00
R1598:Cul7 UTSW 17 46,974,017 (GRCm39) missense probably benign 0.10
R1600:Cul7 UTSW 17 46,962,748 (GRCm39) nonsense probably null
R1618:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R1752:Cul7 UTSW 17 46,964,093 (GRCm39) missense probably benign 0.10
R1881:Cul7 UTSW 17 46,962,888 (GRCm39) missense probably damaging 1.00
R1901:Cul7 UTSW 17 46,966,666 (GRCm39) missense probably damaging 1.00
R1902:Cul7 UTSW 17 46,966,666 (GRCm39) missense probably damaging 1.00
R1913:Cul7 UTSW 17 46,974,116 (GRCm39) missense probably damaging 0.99
R2213:Cul7 UTSW 17 46,962,398 (GRCm39) missense probably damaging 0.99
R2370:Cul7 UTSW 17 46,972,567 (GRCm39) missense probably damaging 1.00
R2929:Cul7 UTSW 17 46,962,526 (GRCm39) missense probably benign 0.00
R2930:Cul7 UTSW 17 46,962,526 (GRCm39) missense probably benign 0.00
R2990:Cul7 UTSW 17 46,962,526 (GRCm39) missense probably benign 0.00
R2992:Cul7 UTSW 17 46,962,526 (GRCm39) missense probably benign 0.00
R4201:Cul7 UTSW 17 46,972,238 (GRCm39) missense probably damaging 1.00
R4792:Cul7 UTSW 17 46,967,976 (GRCm39) nonsense probably null
R4971:Cul7 UTSW 17 46,970,045 (GRCm39) missense probably benign 0.00
R5014:Cul7 UTSW 17 46,966,868 (GRCm39) makesense probably null
R5384:Cul7 UTSW 17 46,965,403 (GRCm39) missense probably benign 0.44
R5957:Cul7 UTSW 17 46,968,683 (GRCm39) missense probably damaging 1.00
R6128:Cul7 UTSW 17 46,962,588 (GRCm39) missense probably damaging 1.00
R6294:Cul7 UTSW 17 46,974,074 (GRCm39) missense probably benign
R6812:Cul7 UTSW 17 46,972,335 (GRCm39) missense probably benign 0.00
R7073:Cul7 UTSW 17 46,969,657 (GRCm39) missense probably damaging 1.00
R7112:Cul7 UTSW 17 46,962,624 (GRCm39) missense probably damaging 1.00
R7246:Cul7 UTSW 17 46,972,993 (GRCm39) missense probably benign 0.04
R7361:Cul7 UTSW 17 46,967,933 (GRCm39) missense probably damaging 1.00
R7567:Cul7 UTSW 17 46,965,521 (GRCm39) missense probably benign 0.00
R7682:Cul7 UTSW 17 46,966,521 (GRCm39) missense probably benign
R7689:Cul7 UTSW 17 46,963,747 (GRCm39) nonsense probably null
R7797:Cul7 UTSW 17 46,969,568 (GRCm39) missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46,968,931 (GRCm39) missense probably benign
R8783:Cul7 UTSW 17 46,966,575 (GRCm39) missense probably benign
R9167:Cul7 UTSW 17 46,966,623 (GRCm39) missense probably benign 0.14
R9614:Cul7 UTSW 17 46,975,212 (GRCm39) missense probably damaging 1.00
Z1177:Cul7 UTSW 17 46,970,495 (GRCm39) missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46,969,664 (GRCm39) missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46,963,731 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCAGAGATGCAAGGGTCGG -3'
(R):5'- TTTCCCAAAGGCAGGTCTCTC -3'

Sequencing Primer
(F):5'- TGCCAGCCACAAGAGGTTCAG -3'
(R):5'- AGGTCTCTCTGCTGCTGTCTG -3'
Posted On 2021-11-19