Mutagenetix > Incidental Mutation

Incidental Mutation 'R9047:Plekhh2'

688154

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R9047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84590762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 944 (S944P)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably damaging
Transcript: ENSMUST00000047206
AA Change: S944P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: S944P

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (76/76)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,939,093	S156T	probably damaging	Het
4930522L14Rik	A	G	5: 109,737,554	L146P		Het
Adra1a	T	A	14: 66,638,185	M203K	probably damaging	Het
Adtrp	G	A	13: 41,816,160	T89I	possibly damaging	Het
Akt3	G	T	1: 177,059,389	T298K	probably damaging	Het
Aldh4a1	G	T	4: 139,623,200		probably benign	Het
Aplf	T	C	6: 87,663,797	T77A	possibly damaging	Het
Arid4b	T	A	13: 14,181,230	W618R	probably damaging	Het
Asxl3	C	A	18: 22,452,408	P130Q	probably damaging	Het
Asxl3	A	G	18: 22,452,414	K132R	probably damaging	Het
Atp11a	T	C	8: 12,828,483	M353T	probably damaging	Het
Atp11b	A	G	3: 35,806,889	D375G	probably damaging	Het
BC052040	A	G	2: 115,777,023	T286A	probably benign	Het
Cage1	C	T	13: 38,017,362	A656T	possibly damaging	Het
Casz1	C	T	4: 148,939,040	P801S	probably damaging	Het
Ccdc130	C	T	8: 84,263,898	R35Q	probably damaging	Het
Ccdc144b	A	G	3: 36,032,884	I187T	probably benign	Het
Cdc14b	A	T	13: 64,220,944		probably benign	Het
Cox6b2	A	G	7: 4,752,087	F63L	probably benign	Het
Cramp1l	A	C	17: 24,979,629	V773G	possibly damaging	Het
Cul7	A	G	17: 46,654,522	E542G	probably benign	Het
Cyp2c55	T	C	19: 39,031,346	Y243H	possibly damaging	Het
Dnah9	C	A	11: 66,072,099	D1797Y	possibly damaging	Het
Dpep2	C	A	8: 105,989,312	A298S		Het
Dvl3	G	A	16: 20,524,076		probably null	Het
Enpp3	T	C	10: 24,798,274	D376G	possibly damaging	Het
Ffar4	T	C	19: 38,113,784	I289T	possibly damaging	Het
Gm3417	A	G	17: 14,967,680	Y111H	probably damaging	Het
Gm5565	T	C	5: 146,158,039	Y299C	probably damaging	Het
Gm8765	C	T	13: 50,702,092	R589*	probably null	Het
Gpat3	A	T	5: 100,846,922	M39L	probably benign	Het
Gpr153	T	C	4: 152,280,207	L240P	probably damaging	Het
Gpr182	T	C	10: 127,750,648	I145V	probably benign	Het
H2-Q4	A	T	17: 35,379,993	T80S	possibly damaging	Het
Hnf1a	T	A	5: 114,950,823	T545S	probably benign	Het
Kif5b	A	C	18: 6,208,261	F946V	probably benign	Het
Krtap16-1	C	T	11: 99,986,341	C79Y	probably damaging	Het
Lama2	A	G	10: 27,006,701	V2622A	possibly damaging	Het
Lrrc37a	T	A	11: 103,500,549	Q1350L	probably damaging	Het
Map2k2	G	A	10: 81,119,664	V294I	probably benign	Het
Mtus1	G	A	8: 41,083,723	H319Y	possibly damaging	Het
Ncdn	T	C	4: 126,750,828	D67G	possibly damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp9b	A	G	7: 20,023,476	I213V	possibly damaging	Het
Nyap2	G	A	1: 81,298,088	R649H	possibly damaging	Het
Olfr1165-ps	T	G	2: 88,101,072	D305A	unknown	Het
Olfr1200	C	A	2: 88,767,955	R120L	probably damaging	Het
Olfr304	A	G	7: 86,386,040	S207P	probably benign	Het
Pi4kb	T	A	3: 94,993,117	L354Q	probably damaging	Het
Podn	C	T	4: 108,021,546	V375M	probably damaging	Het
Pramef8	C	A	4: 143,419,103	Q381K	possibly damaging	Het
Psmb2	T	A	4: 126,706,102	H110Q	probably benign	Het
Rasip1	A	G	7: 45,632,642	E523G	possibly damaging	Het
Ripor1	T	G	8: 105,616,151	C219G	probably damaging	Het
Rps6ka2	G	C	17: 7,300,279	V714L	probably damaging	Het
Sass6	G	T	3: 116,613,998	L254F	probably damaging	Het
Scarf2	G	A	16: 17,806,406	G525E	probably damaging	Het
Sh3d21	T	A	4: 126,152,338		probably benign	Het
Sh3tc1	C	A	5: 35,706,483	A787S	probably benign	Het
Skint5	T	A	4: 113,655,722	N871I	unknown	Het
Slc48a1	T	G	15: 97,789,952	D62E	probably damaging	Het
Slc6a21	G	A	7: 45,286,974	M157I		Het
Slurp2	T	C	15: 74,743,112	D60G	probably benign	Het
Sparcl1	G	T	5: 104,093,113	N148K	possibly damaging	Het
Spsb2	T	A	6: 124,810,013	N236K	probably benign	Het
Sptb	G	T	12: 76,632,534		probably benign	Het
Ssc4d	A	T	5: 135,961,176	C41S	probably damaging	Het
Tecta	A	T	9: 42,375,079	D760E	probably benign	Het
Tesmin	G	T	19: 3,389,431		probably benign	Het
Tiam1	A	C	16: 89,804,888		probably benign	Het
Tldc1	T	C	8: 119,762,311	N411S	probably benign	Het
Tnrc6a	T	C	7: 123,179,723	L1219S	probably damaging	Het
Tram1	T	G	1: 13,569,606	I306L	probably benign	Het
Trank1	A	C	9: 111,362,432	D503A	probably damaging	Het
Ttc21b	T	C	2: 66,201,252	H1044R		Het
Ubac2	T	C	14: 121,908,214	F95L	probably benign	Het
Vmn2r91	A	T	17: 18,106,034	M194L	probably benign	Het
Zdhhc1	G	T	8: 105,478,901	H90Q	probably damaging	Het
Zfp169	C	T	13: 48,498,816	V42I	probably damaging	Het
Zfp81	A	G	17: 33,334,413	C476R	probably damaging	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCCTGAGGGTGACAGAAAAC -3'
(R):5'- GTGGAACAGTGCTCGTTTCTC -3'

Sequencing Primer
(F):5'- TGACAGAAAACAGCCTTGCTAG -3'
(R):5'- GGAACAGTGCTCGTTTCTCTCAAC -3'

Posted On

2021-11-19