Mutagenetix > Incidental Mutation

Incidental Mutation 'R9047:Asxl3'

688157

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R9047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22452414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 132 (K132R)

Ref Sequence

ENSEMBL: ENSMUSP00000095260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097655
AA Change: K132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: K132R

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120223
AA Change: K132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: K132R

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (76/76)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,939,093	S156T	probably damaging	Het
4930522L14Rik	A	G	5: 109,737,554	L146P		Het
Adra1a	T	A	14: 66,638,185	M203K	probably damaging	Het
Adtrp	G	A	13: 41,816,160	T89I	possibly damaging	Het
Akt3	G	T	1: 177,059,389	T298K	probably damaging	Het
Aldh4a1	G	T	4: 139,623,200		probably benign	Het
Aplf	T	C	6: 87,663,797	T77A	possibly damaging	Het
Arid4b	T	A	13: 14,181,230	W618R	probably damaging	Het
Atp11a	T	C	8: 12,828,483	M353T	probably damaging	Het
Atp11b	A	G	3: 35,806,889	D375G	probably damaging	Het
BC052040	A	G	2: 115,777,023	T286A	probably benign	Het
Cage1	C	T	13: 38,017,362	A656T	possibly damaging	Het
Casz1	C	T	4: 148,939,040	P801S	probably damaging	Het
Ccdc130	C	T	8: 84,263,898	R35Q	probably damaging	Het
Ccdc144b	A	G	3: 36,032,884	I187T	probably benign	Het
Cdc14b	A	T	13: 64,220,944		probably benign	Het
Cox6b2	A	G	7: 4,752,087	F63L	probably benign	Het
Cramp1l	A	C	17: 24,979,629	V773G	possibly damaging	Het
Cul7	A	G	17: 46,654,522	E542G	probably benign	Het
Cyp2c55	T	C	19: 39,031,346	Y243H	possibly damaging	Het
Dnah9	C	A	11: 66,072,099	D1797Y	possibly damaging	Het
Dpep2	C	A	8: 105,989,312	A298S		Het
Dvl3	G	A	16: 20,524,076		probably null	Het
Enpp3	T	C	10: 24,798,274	D376G	possibly damaging	Het
Ffar4	T	C	19: 38,113,784	I289T	possibly damaging	Het
Gm3417	A	G	17: 14,967,680	Y111H	probably damaging	Het
Gm5565	T	C	5: 146,158,039	Y299C	probably damaging	Het
Gm8765	C	T	13: 50,702,092	R589*	probably null	Het
Gpat3	A	T	5: 100,846,922	M39L	probably benign	Het
Gpr153	T	C	4: 152,280,207	L240P	probably damaging	Het
Gpr182	T	C	10: 127,750,648	I145V	probably benign	Het
H2-Q4	A	T	17: 35,379,993	T80S	possibly damaging	Het
Hnf1a	T	A	5: 114,950,823	T545S	probably benign	Het
Kif5b	A	C	18: 6,208,261	F946V	probably benign	Het
Krtap16-1	C	T	11: 99,986,341	C79Y	probably damaging	Het
Lama2	A	G	10: 27,006,701	V2622A	possibly damaging	Het
Lrrc37a	T	A	11: 103,500,549	Q1350L	probably damaging	Het
Map2k2	G	A	10: 81,119,664	V294I	probably benign	Het
Mtus1	G	A	8: 41,083,723	H319Y	possibly damaging	Het
Ncdn	T	C	4: 126,750,828	D67G	possibly damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp9b	A	G	7: 20,023,476	I213V	possibly damaging	Het
Nyap2	G	A	1: 81,298,088	R649H	possibly damaging	Het
Olfr1165-ps	T	G	2: 88,101,072	D305A	unknown	Het
Olfr1200	C	A	2: 88,767,955	R120L	probably damaging	Het
Olfr304	A	G	7: 86,386,040	S207P	probably benign	Het
Pi4kb	T	A	3: 94,993,117	L354Q	probably damaging	Het
Plekhh2	T	C	17: 84,590,762	S944P	probably damaging	Het
Podn	C	T	4: 108,021,546	V375M	probably damaging	Het
Pramef8	C	A	4: 143,419,103	Q381K	possibly damaging	Het
Psmb2	T	A	4: 126,706,102	H110Q	probably benign	Het
Rasip1	A	G	7: 45,632,642	E523G	possibly damaging	Het
Ripor1	T	G	8: 105,616,151	C219G	probably damaging	Het
Rps6ka2	G	C	17: 7,300,279	V714L	probably damaging	Het
Sass6	G	T	3: 116,613,998	L254F	probably damaging	Het
Scarf2	G	A	16: 17,806,406	G525E	probably damaging	Het
Sh3d21	T	A	4: 126,152,338		probably benign	Het
Sh3tc1	C	A	5: 35,706,483	A787S	probably benign	Het
Skint5	T	A	4: 113,655,722	N871I	unknown	Het
Slc48a1	T	G	15: 97,789,952	D62E	probably damaging	Het
Slc6a21	G	A	7: 45,286,974	M157I		Het
Slurp2	T	C	15: 74,743,112	D60G	probably benign	Het
Sparcl1	G	T	5: 104,093,113	N148K	possibly damaging	Het
Spsb2	T	A	6: 124,810,013	N236K	probably benign	Het
Sptb	G	T	12: 76,632,534		probably benign	Het
Ssc4d	A	T	5: 135,961,176	C41S	probably damaging	Het
Tecta	A	T	9: 42,375,079	D760E	probably benign	Het
Tesmin	G	T	19: 3,389,431		probably benign	Het
Tiam1	A	C	16: 89,804,888		probably benign	Het
Tldc1	T	C	8: 119,762,311	N411S	probably benign	Het
Tnrc6a	T	C	7: 123,179,723	L1219S	probably damaging	Het
Tram1	T	G	1: 13,569,606	I306L	probably benign	Het
Trank1	A	C	9: 111,362,432	D503A	probably damaging	Het
Ttc21b	T	C	2: 66,201,252	H1044R		Het
Ubac2	T	C	14: 121,908,214	F95L	probably benign	Het
Vmn2r91	A	T	17: 18,106,034	M194L	probably benign	Het
Zdhhc1	G	T	8: 105,478,901	H90Q	probably damaging	Het
Zfp169	C	T	13: 48,498,816	V42I	probably damaging	Het
Zfp81	A	G	17: 33,334,413	C476R	probably damaging	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGATCAGGGGCTCTGTG -3'
(R):5'- ATGGGCTGGTTTCTTAAACACAG -3'

Sequencing Primer
(F):5'- CTCTGTGGAATTGAAGATAGTCATG -3'
(R):5'- CTGGTTTCTTAAACACAGTAACTGGG -3'

Posted On

2021-11-19