Incidental Mutation 'R9048:Siglecg'
ID 688174
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
MMRRC Submission 068874-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9048 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43058003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 7 (L7P)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: L7P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Meta Mutation Damage Score 0.6154 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl A T 16: 45,974,558 (GRCm39) V273D probably damaging Het
Als2 C T 1: 59,225,670 (GRCm39) V947M possibly damaging Het
Bltp1 T C 3: 37,065,926 (GRCm39) S67P Het
Bmp6 C T 13: 38,682,778 (GRCm39) T453I probably damaging Het
Ccdc141 T C 2: 76,853,872 (GRCm39) K1092R probably damaging Het
Ces1f T C 8: 93,989,695 (GRCm39) D407G probably benign Het
Cfap46 G T 7: 139,207,259 (GRCm39) H1887N unknown Het
Cldn10 G A 14: 119,025,656 (GRCm39) V30M probably damaging Het
Col4a1 T A 8: 11,281,944 (GRCm39) probably benign Het
Cyria G A 12: 12,412,286 (GRCm39) A183T probably damaging Het
Dmac2l C T 12: 69,787,752 (GRCm39) R63C probably damaging Het
Enpp7 A G 11: 118,881,455 (GRCm39) H200R probably damaging Het
Entrep3 T C 3: 89,093,048 (GRCm39) Y269H probably damaging Het
Epb41l3 C T 17: 69,517,218 (GRCm39) A82V probably benign Het
Exph5 A G 9: 53,284,935 (GRCm39) H672R possibly damaging Het
Glce A T 9: 61,967,413 (GRCm39) Y579* probably null Het
Gm9507 G A 10: 77,647,245 (GRCm39) P145S unknown Het
Igf2 A T 7: 142,207,759 (GRCm39) F113I probably benign Het
Il1a T C 2: 129,148,441 (GRCm39) S90G probably benign Het
Kalrn A G 16: 33,854,854 (GRCm39) I2002T possibly damaging Het
Kng2 G A 16: 22,806,522 (GRCm39) T559I probably benign Het
Leng8 A G 7: 4,146,931 (GRCm39) probably benign Het
Lpcat2 G T 8: 93,635,878 (GRCm39) A427S probably benign Het
Mapk14 A G 17: 28,947,358 (GRCm39) T175A probably benign Het
Mei1 C A 15: 81,969,036 (GRCm39) S329* probably null Het
Mfsd2a A G 4: 122,854,768 (GRCm39) I20T probably benign Het
Mtcl1 T C 17: 66,678,331 (GRCm39) N665S probably benign Het
Mup5 T A 4: 61,750,612 (GRCm39) Q177L probably benign Het
Nkx6-2 A G 7: 139,161,876 (GRCm39) F167S probably damaging Het
Or10j5 T C 1: 172,784,929 (GRCm39) V189A probably benign Het
Or13c7b T C 4: 43,820,584 (GRCm39) Y259C probably damaging Het
Or2t26 G A 11: 49,039,830 (GRCm39) V249I probably damaging Het
Or2y1c T A 11: 49,361,880 (GRCm39) W301R probably benign Het
Or55b3 A T 7: 102,126,684 (GRCm39) I131N probably damaging Het
Or5h18 G A 16: 58,847,598 (GRCm39) T224I probably benign Het
Pgap6 T C 17: 26,340,515 (GRCm39) V633A probably damaging Het
Phyh A T 2: 4,932,249 (GRCm39) M112L probably benign Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pkn1 G A 8: 84,424,663 (GRCm39) R11C possibly damaging Het
Podn G C 4: 107,878,596 (GRCm39) R424G probably damaging Het
Ptdss2 A G 7: 140,732,797 (GRCm39) D222G probably damaging Het
Ryk A T 9: 102,774,468 (GRCm39) M401L probably benign Het
Sec61g A G 11: 16,458,129 (GRCm39) V22A probably benign Het
Septin8 A G 11: 53,427,530 (GRCm39) N250D probably damaging Het
Sin3a A G 9: 57,032,620 (GRCm39) D1188G probably damaging Het
Sipa1l2 G A 8: 126,174,465 (GRCm39) T1271M possibly damaging Het
Stard9 T A 2: 120,508,415 (GRCm39) L241H probably damaging Het
Stx8 A G 11: 67,902,211 (GRCm39) T132A probably damaging Het
Stxbp2 A G 8: 3,687,218 (GRCm39) I403V Het
Stxbp3 A T 3: 108,723,704 (GRCm39) M177K probably benign Het
Supt16 T A 14: 52,418,513 (GRCm39) Q248L probably damaging Het
Vmn2r91 A T 17: 18,356,122 (GRCm39) L596F probably benign Het
Zkscan3 T C 13: 21,580,686 (GRCm39) M1V probably null Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCAATGGGCTCGAAACTTG -3'
(R):5'- AAGATGCACAGACCCTCCTG -3'

Sequencing Primer
(F):5'- GCAGTTTGTCTTGCACCGGTAC -3'
(R):5'- GTAGGAAGTAGCTCTCCATCTGAC -3'
Posted On 2021-11-19