Incidental Mutation 'R9048:Supt16'
ID 688201
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R9048 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52181056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 248 (Q248L)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: Q248L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: Q248L

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.6260 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,011,777 S67P Het
Als2 C T 1: 59,186,511 V947M possibly damaging Het
Atp5s C T 12: 69,740,978 R63C probably damaging Het
Bmp6 C T 13: 38,498,802 T453I probably damaging Het
Ccdc141 T C 2: 77,023,528 K1092R probably damaging Het
Ces1f T C 8: 93,263,067 D407G probably benign Het
Cfap46 G T 7: 139,627,343 H1887N unknown Het
Cldn10 G A 14: 118,788,244 V30M probably damaging Het
Col4a1 T A 8: 11,231,944 probably benign Het
Enpp7 A G 11: 118,990,629 H200R probably damaging Het
Epb41l3 C T 17: 69,210,223 A82V probably benign Het
Exph5 A G 9: 53,373,635 H672R possibly damaging Het
Fam189b T C 3: 89,185,741 Y269H probably damaging Het
Fam49a G A 12: 12,362,285 A183T probably damaging Het
Glce A T 9: 62,060,131 Y579* probably null Het
Gm4737 A T 16: 46,154,195 V273D probably damaging Het
Gm9507 G A 10: 77,811,411 P145S unknown Het
Igf2 A T 7: 142,654,022 F113I probably benign Het
Il1a T C 2: 129,306,521 S90G probably benign Het
Kalrn A G 16: 34,034,484 I2002T possibly damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Leng8 A G 7: 4,143,932 probably benign Het
Lpcat2 G T 8: 92,909,250 A427S probably benign Het
Mapk14 A G 17: 28,728,384 T175A probably benign Het
Mei1 C A 15: 82,084,835 S329* probably null Het
Mfsd2a A G 4: 122,960,975 I20T probably benign Het
Mtcl1 T C 17: 66,371,336 N665S probably benign Het
Mup5 T A 4: 61,832,375 Q177L probably benign Het
Nkx6-2 A G 7: 139,581,960 F167S probably damaging Het
Olfr1386 T A 11: 49,471,053 W301R probably benign Het
Olfr1395 G A 11: 49,149,003 V249I probably damaging Het
Olfr156 T C 4: 43,820,584 Y259C probably damaging Het
Olfr16 T C 1: 172,957,362 V189A probably benign Het
Olfr186 G A 16: 59,027,235 T224I probably benign Het
Olfr543 A T 7: 102,477,477 I131N probably damaging Het
Phyh A T 2: 4,927,438 M112L probably benign Het
Pip5k1c C A 10: 81,316,876 probably benign Het
Pkn1 G A 8: 83,698,034 R11C possibly damaging Het
Podn G C 4: 108,021,399 R424G probably damaging Het
Ptdss2 A G 7: 141,152,884 D222G probably damaging Het
Ryk A T 9: 102,897,269 M401L probably benign Het
Sec61g A G 11: 16,508,129 V22A probably benign Het
Sept8 A G 11: 53,536,703 N250D probably damaging Het
Siglecg T C 7: 43,408,579 L7P probably benign Het
Sin3a A G 9: 57,125,336 D1188G probably damaging Het
Sipa1l2 G A 8: 125,447,726 T1271M possibly damaging Het
Stard9 T A 2: 120,677,934 L241H probably damaging Het
Stx8 A G 11: 68,011,385 T132A probably damaging Het
Stxbp2 A G 8: 3,637,218 I403V Het
Stxbp3 A T 3: 108,816,388 M177K probably benign Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Vmn2r91 A T 17: 18,135,860 L596F probably benign Het
Zkscan3 T C 13: 21,396,516 M1V probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AGCATCTTAGTTACAGGTATGTGC -3'
(R):5'- AATATCATGCACTTCTGTGTACTACCC -3'

Sequencing Primer
(F):5'- CTCTGGTCCTCATGAGAGAATAGC -3'
(R):5'- GTGTACTACCCTCCAGTGAGTG -3'
Posted On 2021-11-19