Incidental Mutation 'R9048:Supt16'
ID 688201
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name SPT16, facilitates chromatin remodeling subunit
Synonyms Spt16, Fact140, Supt16h, Cdc68
MMRRC Submission 068874-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R9048 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52397876-52434696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52418513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 248 (Q248L)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: Q248L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: Q248L

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.6260 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl A T 16: 45,974,558 (GRCm39) V273D probably damaging Het
Als2 C T 1: 59,225,670 (GRCm39) V947M possibly damaging Het
Bltp1 T C 3: 37,065,926 (GRCm39) S67P Het
Bmp6 C T 13: 38,682,778 (GRCm39) T453I probably damaging Het
Ccdc141 T C 2: 76,853,872 (GRCm39) K1092R probably damaging Het
Ces1f T C 8: 93,989,695 (GRCm39) D407G probably benign Het
Cfap46 G T 7: 139,207,259 (GRCm39) H1887N unknown Het
Cldn10 G A 14: 119,025,656 (GRCm39) V30M probably damaging Het
Col4a1 T A 8: 11,281,944 (GRCm39) probably benign Het
Cyria G A 12: 12,412,286 (GRCm39) A183T probably damaging Het
Dmac2l C T 12: 69,787,752 (GRCm39) R63C probably damaging Het
Enpp7 A G 11: 118,881,455 (GRCm39) H200R probably damaging Het
Entrep3 T C 3: 89,093,048 (GRCm39) Y269H probably damaging Het
Epb41l3 C T 17: 69,517,218 (GRCm39) A82V probably benign Het
Exph5 A G 9: 53,284,935 (GRCm39) H672R possibly damaging Het
Glce A T 9: 61,967,413 (GRCm39) Y579* probably null Het
Gm9507 G A 10: 77,647,245 (GRCm39) P145S unknown Het
Igf2 A T 7: 142,207,759 (GRCm39) F113I probably benign Het
Il1a T C 2: 129,148,441 (GRCm39) S90G probably benign Het
Kalrn A G 16: 33,854,854 (GRCm39) I2002T possibly damaging Het
Kng2 G A 16: 22,806,522 (GRCm39) T559I probably benign Het
Leng8 A G 7: 4,146,931 (GRCm39) probably benign Het
Lpcat2 G T 8: 93,635,878 (GRCm39) A427S probably benign Het
Mapk14 A G 17: 28,947,358 (GRCm39) T175A probably benign Het
Mei1 C A 15: 81,969,036 (GRCm39) S329* probably null Het
Mfsd2a A G 4: 122,854,768 (GRCm39) I20T probably benign Het
Mtcl1 T C 17: 66,678,331 (GRCm39) N665S probably benign Het
Mup5 T A 4: 61,750,612 (GRCm39) Q177L probably benign Het
Nkx6-2 A G 7: 139,161,876 (GRCm39) F167S probably damaging Het
Or10j5 T C 1: 172,784,929 (GRCm39) V189A probably benign Het
Or13c7b T C 4: 43,820,584 (GRCm39) Y259C probably damaging Het
Or2t26 G A 11: 49,039,830 (GRCm39) V249I probably damaging Het
Or2y1c T A 11: 49,361,880 (GRCm39) W301R probably benign Het
Or55b3 A T 7: 102,126,684 (GRCm39) I131N probably damaging Het
Or5h18 G A 16: 58,847,598 (GRCm39) T224I probably benign Het
Pgap6 T C 17: 26,340,515 (GRCm39) V633A probably damaging Het
Phyh A T 2: 4,932,249 (GRCm39) M112L probably benign Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pkn1 G A 8: 84,424,663 (GRCm39) R11C possibly damaging Het
Podn G C 4: 107,878,596 (GRCm39) R424G probably damaging Het
Ptdss2 A G 7: 140,732,797 (GRCm39) D222G probably damaging Het
Ryk A T 9: 102,774,468 (GRCm39) M401L probably benign Het
Sec61g A G 11: 16,458,129 (GRCm39) V22A probably benign Het
Septin8 A G 11: 53,427,530 (GRCm39) N250D probably damaging Het
Siglecg T C 7: 43,058,003 (GRCm39) L7P probably benign Het
Sin3a A G 9: 57,032,620 (GRCm39) D1188G probably damaging Het
Sipa1l2 G A 8: 126,174,465 (GRCm39) T1271M possibly damaging Het
Stard9 T A 2: 120,508,415 (GRCm39) L241H probably damaging Het
Stx8 A G 11: 67,902,211 (GRCm39) T132A probably damaging Het
Stxbp2 A G 8: 3,687,218 (GRCm39) I403V Het
Stxbp3 A T 3: 108,723,704 (GRCm39) M177K probably benign Het
Vmn2r91 A T 17: 18,356,122 (GRCm39) L596F probably benign Het
Zkscan3 T C 13: 21,580,686 (GRCm39) M1V probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52,399,255 (GRCm39) missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52,399,148 (GRCm39) missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52,420,589 (GRCm39) missense probably benign
IGL01328:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01329:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01413:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01414:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01535:Supt16 APN 14 52,414,647 (GRCm39) missense probably damaging 0.99
IGL01765:Supt16 APN 14 52,417,680 (GRCm39) missense probably damaging 0.98
IGL01976:Supt16 APN 14 52,419,764 (GRCm39) missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52,417,000 (GRCm39) missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52,411,263 (GRCm39) missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52,421,421 (GRCm39) missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52,408,335 (GRCm39) missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52,413,855 (GRCm39) missense probably damaging 0.98
IGL03406:Supt16 APN 14 52,415,598 (GRCm39) missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
watercolor UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R0332:Supt16 UTSW 14 52,418,614 (GRCm39) missense probably damaging 0.99
R0385:Supt16 UTSW 14 52,414,175 (GRCm39) missense probably benign 0.01
R0389:Supt16 UTSW 14 52,411,570 (GRCm39) missense probably damaging 0.98
R0422:Supt16 UTSW 14 52,421,453 (GRCm39) missense probably benign 0.26
R1101:Supt16 UTSW 14 52,408,896 (GRCm39) missense probably null 0.81
R1212:Supt16 UTSW 14 52,411,581 (GRCm39) nonsense probably null
R1487:Supt16 UTSW 14 52,414,065 (GRCm39) critical splice donor site probably null
R1494:Supt16 UTSW 14 52,409,916 (GRCm39) missense probably benign 0.01
R1566:Supt16 UTSW 14 52,414,112 (GRCm39) missense probably damaging 0.99
R1652:Supt16 UTSW 14 52,414,637 (GRCm39) missense probably benign 0.34
R1913:Supt16 UTSW 14 52,415,592 (GRCm39) missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52,409,601 (GRCm39) nonsense probably null
R2344:Supt16 UTSW 14 52,415,575 (GRCm39) missense probably benign 0.00
R3430:Supt16 UTSW 14 52,412,816 (GRCm39) missense probably benign 0.05
R3746:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R3749:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R4010:Supt16 UTSW 14 52,401,898 (GRCm39) missense probably damaging 1.00
R4108:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4109:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4597:Supt16 UTSW 14 52,411,046 (GRCm39) missense probably damaging 1.00
R5117:Supt16 UTSW 14 52,420,549 (GRCm39) missense probably damaging 1.00
R5309:Supt16 UTSW 14 52,400,155 (GRCm39) missense probably damaging 1.00
R5695:Supt16 UTSW 14 52,411,601 (GRCm39) splice site probably null
R5895:Supt16 UTSW 14 52,401,979 (GRCm39) missense probably benign 0.17
R5941:Supt16 UTSW 14 52,419,653 (GRCm39) missense probably benign
R5993:Supt16 UTSW 14 52,415,791 (GRCm39) missense probably damaging 1.00
R6197:Supt16 UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R6254:Supt16 UTSW 14 52,408,291 (GRCm39) missense probably damaging 1.00
R6381:Supt16 UTSW 14 52,417,003 (GRCm39) missense probably benign 0.02
R6667:Supt16 UTSW 14 52,409,520 (GRCm39) missense probably damaging 1.00
R7000:Supt16 UTSW 14 52,408,907 (GRCm39) missense probably damaging 0.97
R7063:Supt16 UTSW 14 52,409,505 (GRCm39) missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52,414,458 (GRCm39) missense probably benign
R7336:Supt16 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52,411,028 (GRCm39) missense probably damaging 0.98
R7384:Supt16 UTSW 14 52,418,619 (GRCm39) missense probably damaging 0.99
R7411:Supt16 UTSW 14 52,415,508 (GRCm39) missense probably damaging 1.00
R7586:Supt16 UTSW 14 52,411,013 (GRCm39) missense probably damaging 0.97
R7633:Supt16 UTSW 14 52,434,556 (GRCm39) missense probably benign 0.38
R8024:Supt16 UTSW 14 52,408,332 (GRCm39) missense probably damaging 0.96
R8197:Supt16 UTSW 14 52,411,542 (GRCm39) missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52,408,447 (GRCm39) missense probably damaging 1.00
R8285:Supt16 UTSW 14 52,418,540 (GRCm39) missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52,419,046 (GRCm39) missense probably damaging 1.00
R8531:Supt16 UTSW 14 52,410,020 (GRCm39) missense probably damaging 0.98
R8797:Supt16 UTSW 14 52,409,960 (GRCm39) missense probably damaging 0.99
R8872:Supt16 UTSW 14 52,411,544 (GRCm39) missense probably benign 0.01
R9743:Supt16 UTSW 14 52,408,939 (GRCm39) missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52,418,994 (GRCm39) missense probably null 0.21
Z1177:Supt16 UTSW 14 52,400,742 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGCATCTTAGTTACAGGTATGTGC -3'
(R):5'- AATATCATGCACTTCTGTGTACTACCC -3'

Sequencing Primer
(F):5'- CTCTGGTCCTCATGAGAGAATAGC -3'
(R):5'- GTGTACTACCCTCCAGTGAGTG -3'
Posted On 2021-11-19