Incidental Mutation 'R9048:Gm4737'
ID 688206
Institutional Source Beutler Lab
Gene Symbol Gm4737
Ensembl Gene ENSMUSG00000048087
Gene Name predicted gene 4737
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock # R9048 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 46152985-46155077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46154195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 273 (V273D)
Ref Sequence ENSEMBL: ENSMUSP00000127198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000059524
AA Change: V273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127198
Gene: ENSMUSG00000048087
AA Change: V273D

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,011,777 S67P Het
Als2 C T 1: 59,186,511 V947M possibly damaging Het
Atp5s C T 12: 69,740,978 R63C probably damaging Het
Bmp6 C T 13: 38,498,802 T453I probably damaging Het
Ccdc141 T C 2: 77,023,528 K1092R probably damaging Het
Ces1f T C 8: 93,263,067 D407G probably benign Het
Cfap46 G T 7: 139,627,343 H1887N unknown Het
Cldn10 G A 14: 118,788,244 V30M probably damaging Het
Enpp7 A G 11: 118,990,629 H200R probably damaging Het
Epb41l3 C T 17: 69,210,223 A82V probably benign Het
Exph5 A G 9: 53,373,635 H672R possibly damaging Het
Fam189b T C 3: 89,185,741 Y269H probably damaging Het
Fam49a G A 12: 12,362,285 A183T probably damaging Het
Glce A T 9: 62,060,131 Y579* probably null Het
Gm9507 G A 10: 77,811,411 P145S unknown Het
Igf2 A T 7: 142,654,022 F113I probably benign Het
Il1a T C 2: 129,306,521 S90G probably benign Het
Kalrn A G 16: 34,034,484 I2002T possibly damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Lpcat2 G T 8: 92,909,250 A427S probably benign Het
Mapk14 A G 17: 28,728,384 T175A probably benign Het
Mei1 C A 15: 82,084,835 S329* probably null Het
Mfsd2a A G 4: 122,960,975 I20T probably benign Het
Mtcl1 T C 17: 66,371,336 N665S probably benign Het
Mup5 T A 4: 61,832,375 Q177L probably benign Het
Nkx6-2 A G 7: 139,581,960 F167S probably damaging Het
Olfr1386 T A 11: 49,471,053 W301R probably benign Het
Olfr1395 G A 11: 49,149,003 V249I probably damaging Het
Olfr156 T C 4: 43,820,584 Y259C probably damaging Het
Olfr16 T C 1: 172,957,362 V189A probably benign Het
Olfr186 G A 16: 59,027,235 T224I probably benign Het
Olfr543 A T 7: 102,477,477 I131N probably damaging Het
Phyh A T 2: 4,927,438 M112L probably benign Het
Podn G C 4: 108,021,399 R424G probably damaging Het
Ptdss2 A G 7: 141,152,884 D222G probably damaging Het
Ryk A T 9: 102,897,269 M401L probably benign Het
Sec61g A G 11: 16,508,129 V22A probably benign Het
Sept8 A G 11: 53,536,703 N250D probably damaging Het
Sh2b1 GACCAGCTCAGCCACGGG GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG 7: 126,467,574 probably benign Het
Sh2b1 CCAGCTC CCAGCTCAGCCACGGGGAACAGCTC 7: 126,467,594 probably benign Het
Siglecg T C 7: 43,408,579 L7P probably benign Het
Sin3a A G 9: 57,125,336 D1188G probably damaging Het
Sipa1l2 G A 8: 125,447,726 T1271M possibly damaging Het
Stard9 T A 2: 120,677,934 L241H probably damaging Het
Stx8 A G 11: 68,011,385 T132A probably damaging Het
Stxbp2 A G 8: 3,637,218 I403V Het
Stxbp3 A T 3: 108,816,388 M177K probably benign Het
Supt16 T A 14: 52,181,056 Q248L probably damaging Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Vmn2r91 A T 17: 18,135,860 L596F probably benign Het
Zkscan3 T C 13: 21,396,516 M1V probably null Het
Other mutations in Gm4737
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Gm4737 APN 16 46154078 missense probably benign
IGL03347:Gm4737 APN 16 46154489 missense probably benign 0.01
R0326:Gm4737 UTSW 16 46153883 missense probably benign 0.03
R0552:Gm4737 UTSW 16 46154592 missense probably benign
R0610:Gm4737 UTSW 16 46153901 missense probably damaging 1.00
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1473:Gm4737 UTSW 16 46154819 missense probably damaging 1.00
R2997:Gm4737 UTSW 16 46153925 missense possibly damaging 0.83
R4546:Gm4737 UTSW 16 46153967 missense possibly damaging 0.81
R4818:Gm4737 UTSW 16 46154192 missense probably damaging 1.00
R6544:Gm4737 UTSW 16 46154784 missense probably benign
R7358:Gm4737 UTSW 16 46153838 missense probably damaging 1.00
R7689:Gm4737 UTSW 16 46154607 missense probably benign 0.12
R8260:Gm4737 UTSW 16 46154423 missense probably damaging 1.00
R9041:Gm4737 UTSW 16 46154105 missense possibly damaging 0.86
Z1176:Gm4737 UTSW 16 46154229 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGCCCATTCTTTAGCCAGTAGC -3'
(R):5'- TAGATGGCATCAAACGGGCC -3'

Sequencing Primer
(F):5'- AGTAGCGGTCCACCTGG -3'
(R):5'- CATCAAACGGGCCACAGATGTG -3'
Posted On 2021-11-19