Incidental Mutation 'R9049:Pramel5'
ID688230
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Namepreferentially expressed antigen in melanoma like 5
SynonymsOTTMUSG00000010540
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R9049 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144270633-144280488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144273916 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 30 (N30S)
Ref Sequence ENSEMBL: ENSMUSP00000044222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect probably benign
Transcript: ENSMUST00000035757
AA Change: N30S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: N30S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105752
AA Change: N30S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: N30S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,038 Y323C probably benign Het
3110009E18Rik A G 1: 120,188,170 I118V probably null Het
3110043O21Rik A G 4: 35,192,964 I455T unknown Het
Abcc9 A G 6: 142,682,932 L362P probably damaging Het
Adam7 C A 14: 68,525,225 V184F probably benign Het
Adgre4 T C 17: 55,785,094 I118T probably benign Het
Akap9 T C 5: 4,064,597 L3292P Het
Akr1b10 A G 6: 34,396,626 E308G possibly damaging Het
Ash1l T C 3: 89,007,364 V1767A probably benign Het
Bpifb3 C A 2: 153,925,890 N294K probably benign Het
Bpifb5 A G 2: 154,228,176 N182S probably benign Het
Camkmt A G 17: 85,402,484 I205M possibly damaging Het
Ccdc88b C T 19: 6,849,074 R1091Q probably benign Het
Cfap58 A T 19: 48,026,718 probably null Het
Clca1 T A 3: 145,027,382 I122L probably benign Het
Col6a3 T A 1: 90,779,344 S2623C unknown Het
Cpne5 A G 17: 29,160,358 S484P probably damaging Het
Cyp4f39 T A 17: 32,486,991 L352Q probably damaging Het
Dcun1d1 T C 3: 35,897,849 N183D probably benign Het
Dgkg A G 16: 22,600,588 V54A probably benign Het
Dnah12 T A 14: 26,722,120 D561E probably benign Het
Dnah6 A C 6: 73,142,292 L1536R probably damaging Het
Gm15448 T A 7: 3,816,891 T676S unknown Het
Gm21834 G A 17: 57,741,831 T130I possibly damaging Het
Hectd4 T A 5: 121,313,892 V434E possibly damaging Het
Htr3a C A 9: 48,899,787 V459L probably damaging Het
Mdfi C A 17: 47,824,554 V84L probably damaging Het
Mdm1 C T 10: 118,146,700 T80M probably benign Het
Muc5ac A C 7: 141,808,975 I2008L unknown Het
Nomo1 A G 7: 46,066,173 D681G probably benign Het
Olfr1030 A G 2: 85,983,891 E17G possibly damaging Het
Olfr127 G A 17: 37,903,873 W109* probably null Het
Olfr193 T G 16: 59,110,400 D70A probably damaging Het
Olfr366 C G 2: 37,219,947 H153D probably damaging Het
Olfr406 A G 11: 74,270,289 K300R possibly damaging Het
Olfr860 T C 9: 19,845,749 Y290C probably damaging Het
Olfr979 G T 9: 40,000,623 N201K possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pld3 C T 7: 27,535,868 V312M possibly damaging Het
Pnisr T A 4: 21,854,391 W12R unknown Het
Polr3e A G 7: 120,939,239 K410R probably benign Het
Ppif G T 14: 25,694,412 V61L possibly damaging Het
Prex2 T G 1: 11,185,906 L1167R probably damaging Het
Prl3a1 T A 13: 27,276,184 L217H probably damaging Het
Prop1 G C 11: 50,952,121 Q80E probably damaging Het
Psma1 T C 7: 114,266,529 I214V probably benign Het
Ptgfr T A 3: 151,835,767 I35F probably benign Het
Rcvrn A T 11: 67,695,742 Y109F probably benign Het
Repin1 A G 6: 48,597,712 D525G possibly damaging Het
Slc12a2 A T 18: 57,921,791 R835* probably null Het
Sqle T C 15: 59,317,862 F118L probably benign Het
Stard9 A T 2: 120,679,937 Y333F probably benign Het
Tbc1d16 G A 11: 119,209,264 R95C probably damaging Het
Tln1 C A 4: 43,549,786 E542* probably null Het
Tmem161b G T 13: 84,294,635 A407S probably benign Het
Tnc G T 4: 64,000,010 D1221E possibly damaging Het
Tnks T C 8: 34,841,778 K1109R probably damaging Het
Tpp2 T C 1: 43,953,342 V194A possibly damaging Het
Ust G A 10: 8,307,454 Q162* probably null Het
Utp15 T C 13: 98,259,270 Y68C probably damaging Het
Vcan A T 13: 89,678,105 H3193Q probably damaging Het
Vmn2r55 T C 7: 12,684,981 Y4C probably damaging Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144271621 missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144273979 missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144271272 missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144271162 utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144273859 missense probably benign 0.01
IGL02150:Pramel5 APN 4 144273201 missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144271551 missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144273112 missense probably benign 0.25
IGL02868:Pramel5 APN 4 144271352 missense probably benign 0.03
IGL02981:Pramel5 APN 4 144272860 missense probably benign 0.01
R0532:Pramel5 UTSW 4 144272740 missense probably benign 0.03
R0646:Pramel5 UTSW 4 144271620 missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144271488 missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144273863 nonsense probably null
R2027:Pramel5 UTSW 4 144271704 missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144272936 nonsense probably null
R2439:Pramel5 UTSW 4 144273740 missense probably benign 0.01
R3922:Pramel5 UTSW 4 144273052 missense probably damaging 1.00
R4470:Pramel5 UTSW 4 144271345 missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 144272755 missense probably benign 0.04
R4969:Pramel5 UTSW 4 144271617 missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144271741 missense probably benign 0.01
R5198:Pramel5 UTSW 4 144273494 intron probably benign
R5930:Pramel5 UTSW 4 144272983 missense probably benign 0.43
R5988:Pramel5 UTSW 4 144273146 missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144273105 missense probably benign 0.32
R6988:Pramel5 UTSW 4 144274007 start gained probably benign
R7116:Pramel5 UTSW 4 144273881 missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144271440 missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 144272825 missense probably damaging 1.00
R8993:Pramel5 UTSW 4 144272959 missense possibly damaging 0.81
X0028:Pramel5 UTSW 4 144272836 missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144273860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGACATCAGCAAATCAAGGCC -3'
(R):5'- AGTGATTGGTCCTCTGCCTG -3'

Sequencing Primer
(F):5'- AGGCCATCTAGTACAGCTTTCAGG -3'
(R):5'- ATTGGTCCTCTGCCTGGTTTATG -3'
Posted On2021-11-19