Incidental Mutation 'R9049:Pramel5'
ID 688230
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Name PRAME like 5
Synonyms OTTMUSG00000010540
MMRRC Submission 068875-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143997203-144007036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144000486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 30 (N30S)
Ref Sequence ENSEMBL: ENSMUSP00000044222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect probably benign
Transcript: ENSMUST00000035757
AA Change: N30S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: N30S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105752
AA Change: N30S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: N30S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,115,900 (GRCm39) I118V probably null Het
Abcc9 A G 6: 142,628,658 (GRCm39) L362P probably damaging Het
Adam7 C A 14: 68,762,674 (GRCm39) V184F probably benign Het
Adgre4 T C 17: 56,092,094 (GRCm39) I118T probably benign Het
Akap9 T C 5: 4,114,597 (GRCm39) L3292P Het
Akr1b10 A G 6: 34,373,561 (GRCm39) E308G possibly damaging Het
Aopep A G 13: 63,208,852 (GRCm39) Y323C probably benign Het
Ash1l T C 3: 88,914,671 (GRCm39) V1767A probably benign Het
Bpifb3 C A 2: 153,767,810 (GRCm39) N294K probably benign Het
Bpifb5 A G 2: 154,070,096 (GRCm39) N182S probably benign Het
C9orf72 A G 4: 35,192,964 (GRCm39) I455T unknown Het
Camkmt A G 17: 85,709,912 (GRCm39) I205M possibly damaging Het
Ccdc88b C T 19: 6,826,442 (GRCm39) R1091Q probably benign Het
Cfap58 A T 19: 48,015,157 (GRCm39) probably null Het
Clca3a1 T A 3: 144,733,143 (GRCm39) I122L probably benign Het
Col6a3 T A 1: 90,707,066 (GRCm39) S2623C unknown Het
Cpne5 A G 17: 29,379,332 (GRCm39) S484P probably damaging Het
Cyp4f39 T A 17: 32,705,965 (GRCm39) L352Q probably damaging Het
Dcun1d1 T C 3: 35,951,998 (GRCm39) N183D probably benign Het
Dgkg A G 16: 22,419,338 (GRCm39) V54A probably benign Het
Dnah12 T A 14: 26,443,275 (GRCm39) D561E probably benign Het
Dnah6 A C 6: 73,119,275 (GRCm39) L1536R probably damaging Het
Gm21834 G A 17: 58,048,826 (GRCm39) T130I possibly damaging Het
Hectd4 T A 5: 121,451,955 (GRCm39) V434E possibly damaging Het
Htr3a C A 9: 48,811,087 (GRCm39) V459L probably damaging Het
Lonp2 T C 8: 87,435,735 (GRCm39) V657A probably benign Het
Mdfi C A 17: 48,135,479 (GRCm39) V84L probably damaging Het
Mdm1 C T 10: 117,982,605 (GRCm39) T80M probably benign Het
Muc5ac A C 7: 141,362,712 (GRCm39) I2008L unknown Het
Nomo1 A G 7: 45,715,597 (GRCm39) D681G probably benign Het
Or10g9 G T 9: 39,911,919 (GRCm39) N201K possibly damaging Het
Or14j6 G A 17: 38,214,764 (GRCm39) W109* probably null Het
Or1af1 C G 2: 37,109,959 (GRCm39) H153D probably damaging Het
Or1p1c A G 11: 74,161,115 (GRCm39) K300R possibly damaging Het
Or5h25 T G 16: 58,930,763 (GRCm39) D70A probably damaging Het
Or5m5 A G 2: 85,814,235 (GRCm39) E17G possibly damaging Het
Or7e169 T C 9: 19,757,045 (GRCm39) Y290C probably damaging Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pipox A G 11: 77,772,380 (GRCm39) I330T probably damaging Het
Pira13 T A 7: 3,819,890 (GRCm39) T676S unknown Het
Pld3 C T 7: 27,235,293 (GRCm39) V312M possibly damaging Het
Pnisr T A 4: 21,854,391 (GRCm39) W12R unknown Het
Polr3e A G 7: 120,538,462 (GRCm39) K410R probably benign Het
Ppif G T 14: 25,694,836 (GRCm39) V61L possibly damaging Het
Prex2 T G 1: 11,256,130 (GRCm39) L1167R probably damaging Het
Prkacb A T 3: 146,461,518 (GRCm39) probably benign Het
Prl3a1 T A 13: 27,460,167 (GRCm39) L217H probably damaging Het
Prop1 G C 11: 50,842,948 (GRCm39) Q80E probably damaging Het
Psma1 T C 7: 113,865,764 (GRCm39) I214V probably benign Het
Ptgfr T A 3: 151,541,404 (GRCm39) I35F probably benign Het
Rcvrn A T 11: 67,586,568 (GRCm39) Y109F probably benign Het
Repin1 A G 6: 48,574,646 (GRCm39) D525G possibly damaging Het
Slc12a2 A T 18: 58,054,863 (GRCm39) R835* probably null Het
Sqle T C 15: 59,189,711 (GRCm39) F118L probably benign Het
Stard9 A T 2: 120,510,418 (GRCm39) Y333F probably benign Het
Tbc1d16 G A 11: 119,100,090 (GRCm39) R95C probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Tmem161b G T 13: 84,442,754 (GRCm39) A407S probably benign Het
Tnc G T 4: 63,918,247 (GRCm39) D1221E possibly damaging Het
Tnks T C 8: 35,308,932 (GRCm39) K1109R probably damaging Het
Tpp2 T C 1: 43,992,502 (GRCm39) V194A possibly damaging Het
Ust G A 10: 8,183,218 (GRCm39) Q162* probably null Het
Utp15 T C 13: 98,395,778 (GRCm39) Y68C probably damaging Het
Vcan A T 13: 89,826,224 (GRCm39) H3193Q probably damaging Het
Vmn2r55 T C 7: 12,418,908 (GRCm39) Y4C probably damaging Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 143,998,191 (GRCm39) missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144,000,549 (GRCm39) missense probably damaging 1.00
IGL01070:Pramel5 APN 4 143,997,842 (GRCm39) missense probably damaging 1.00
IGL01298:Pramel5 APN 4 143,997,732 (GRCm39) utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144,000,429 (GRCm39) missense probably benign 0.01
IGL02150:Pramel5 APN 4 143,999,771 (GRCm39) missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 143,998,121 (GRCm39) missense probably damaging 1.00
IGL02671:Pramel5 APN 4 143,999,682 (GRCm39) missense probably benign 0.25
IGL02868:Pramel5 APN 4 143,997,922 (GRCm39) missense probably benign 0.03
IGL02981:Pramel5 APN 4 143,999,430 (GRCm39) missense probably benign 0.01
R0532:Pramel5 UTSW 4 143,999,310 (GRCm39) missense probably benign 0.03
R0646:Pramel5 UTSW 4 143,998,190 (GRCm39) missense probably damaging 1.00
R1328:Pramel5 UTSW 4 143,998,058 (GRCm39) missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144,000,433 (GRCm39) nonsense probably null
R2027:Pramel5 UTSW 4 143,998,274 (GRCm39) missense probably damaging 1.00
R2240:Pramel5 UTSW 4 143,999,506 (GRCm39) nonsense probably null
R2439:Pramel5 UTSW 4 144,000,310 (GRCm39) missense probably benign 0.01
R3922:Pramel5 UTSW 4 143,999,622 (GRCm39) missense probably damaging 1.00
R4470:Pramel5 UTSW 4 143,997,915 (GRCm39) missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 143,999,325 (GRCm39) missense probably benign 0.04
R4969:Pramel5 UTSW 4 143,998,187 (GRCm39) missense probably damaging 1.00
R5195:Pramel5 UTSW 4 143,998,311 (GRCm39) missense probably benign 0.01
R5198:Pramel5 UTSW 4 144,000,064 (GRCm39) intron probably benign
R5930:Pramel5 UTSW 4 143,999,553 (GRCm39) missense probably benign 0.43
R5988:Pramel5 UTSW 4 143,999,716 (GRCm39) missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 143,999,675 (GRCm39) missense probably benign 0.32
R6988:Pramel5 UTSW 4 144,000,577 (GRCm39) start gained probably benign
R7116:Pramel5 UTSW 4 144,000,451 (GRCm39) missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 143,998,010 (GRCm39) missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 143,999,395 (GRCm39) missense probably damaging 1.00
R8993:Pramel5 UTSW 4 143,999,529 (GRCm39) missense possibly damaging 0.81
R9402:Pramel5 UTSW 4 143,998,026 (GRCm39) missense probably benign 0.15
R9632:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
R9710:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
X0028:Pramel5 UTSW 4 143,999,406 (GRCm39) missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144,000,430 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGACATCAGCAAATCAAGGCC -3'
(R):5'- AGTGATTGGTCCTCTGCCTG -3'

Sequencing Primer
(F):5'- AGGCCATCTAGTACAGCTTTCAGG -3'
(R):5'- ATTGGTCCTCTGCCTGGTTTATG -3'
Posted On 2021-11-19