Incidental Mutation 'R9049:Dnah6'
ID 688235
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 068875-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72994589-73198634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73119275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1536 (L1536R)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064948
AA Change: L1536R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: L1536R

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: L1484R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: L1484R

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204053
AA Change: L1536R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: L1536R

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,115,900 (GRCm39) I118V probably null Het
Abcc9 A G 6: 142,628,658 (GRCm39) L362P probably damaging Het
Adam7 C A 14: 68,762,674 (GRCm39) V184F probably benign Het
Adgre4 T C 17: 56,092,094 (GRCm39) I118T probably benign Het
Akap9 T C 5: 4,114,597 (GRCm39) L3292P Het
Akr1b10 A G 6: 34,373,561 (GRCm39) E308G possibly damaging Het
Aopep A G 13: 63,208,852 (GRCm39) Y323C probably benign Het
Ash1l T C 3: 88,914,671 (GRCm39) V1767A probably benign Het
Bpifb3 C A 2: 153,767,810 (GRCm39) N294K probably benign Het
Bpifb5 A G 2: 154,070,096 (GRCm39) N182S probably benign Het
C9orf72 A G 4: 35,192,964 (GRCm39) I455T unknown Het
Camkmt A G 17: 85,709,912 (GRCm39) I205M possibly damaging Het
Ccdc88b C T 19: 6,826,442 (GRCm39) R1091Q probably benign Het
Cfap58 A T 19: 48,015,157 (GRCm39) probably null Het
Clca3a1 T A 3: 144,733,143 (GRCm39) I122L probably benign Het
Col6a3 T A 1: 90,707,066 (GRCm39) S2623C unknown Het
Cpne5 A G 17: 29,379,332 (GRCm39) S484P probably damaging Het
Cyp4f39 T A 17: 32,705,965 (GRCm39) L352Q probably damaging Het
Dcun1d1 T C 3: 35,951,998 (GRCm39) N183D probably benign Het
Dgkg A G 16: 22,419,338 (GRCm39) V54A probably benign Het
Dnah12 T A 14: 26,443,275 (GRCm39) D561E probably benign Het
Gm21834 G A 17: 58,048,826 (GRCm39) T130I possibly damaging Het
Hectd4 T A 5: 121,451,955 (GRCm39) V434E possibly damaging Het
Htr3a C A 9: 48,811,087 (GRCm39) V459L probably damaging Het
Lonp2 T C 8: 87,435,735 (GRCm39) V657A probably benign Het
Mdfi C A 17: 48,135,479 (GRCm39) V84L probably damaging Het
Mdm1 C T 10: 117,982,605 (GRCm39) T80M probably benign Het
Muc5ac A C 7: 141,362,712 (GRCm39) I2008L unknown Het
Nomo1 A G 7: 45,715,597 (GRCm39) D681G probably benign Het
Or10g9 G T 9: 39,911,919 (GRCm39) N201K possibly damaging Het
Or14j6 G A 17: 38,214,764 (GRCm39) W109* probably null Het
Or1af1 C G 2: 37,109,959 (GRCm39) H153D probably damaging Het
Or1p1c A G 11: 74,161,115 (GRCm39) K300R possibly damaging Het
Or5h25 T G 16: 58,930,763 (GRCm39) D70A probably damaging Het
Or5m5 A G 2: 85,814,235 (GRCm39) E17G possibly damaging Het
Or7e169 T C 9: 19,757,045 (GRCm39) Y290C probably damaging Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pipox A G 11: 77,772,380 (GRCm39) I330T probably damaging Het
Pira13 T A 7: 3,819,890 (GRCm39) T676S unknown Het
Pld3 C T 7: 27,235,293 (GRCm39) V312M possibly damaging Het
Pnisr T A 4: 21,854,391 (GRCm39) W12R unknown Het
Polr3e A G 7: 120,538,462 (GRCm39) K410R probably benign Het
Ppif G T 14: 25,694,836 (GRCm39) V61L possibly damaging Het
Pramel5 T C 4: 144,000,486 (GRCm39) N30S probably benign Het
Prex2 T G 1: 11,256,130 (GRCm39) L1167R probably damaging Het
Prkacb A T 3: 146,461,518 (GRCm39) probably benign Het
Prl3a1 T A 13: 27,460,167 (GRCm39) L217H probably damaging Het
Prop1 G C 11: 50,842,948 (GRCm39) Q80E probably damaging Het
Psma1 T C 7: 113,865,764 (GRCm39) I214V probably benign Het
Ptgfr T A 3: 151,541,404 (GRCm39) I35F probably benign Het
Rcvrn A T 11: 67,586,568 (GRCm39) Y109F probably benign Het
Repin1 A G 6: 48,574,646 (GRCm39) D525G possibly damaging Het
Slc12a2 A T 18: 58,054,863 (GRCm39) R835* probably null Het
Sqle T C 15: 59,189,711 (GRCm39) F118L probably benign Het
Stard9 A T 2: 120,510,418 (GRCm39) Y333F probably benign Het
Tbc1d16 G A 11: 119,100,090 (GRCm39) R95C probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Tmem161b G T 13: 84,442,754 (GRCm39) A407S probably benign Het
Tnc G T 4: 63,918,247 (GRCm39) D1221E possibly damaging Het
Tnks T C 8: 35,308,932 (GRCm39) K1109R probably damaging Het
Tpp2 T C 1: 43,992,502 (GRCm39) V194A possibly damaging Het
Ust G A 10: 8,183,218 (GRCm39) Q162* probably null Het
Utp15 T C 13: 98,395,778 (GRCm39) Y68C probably damaging Het
Vcan A T 13: 89,826,224 (GRCm39) H3193Q probably damaging Het
Vmn2r55 T C 7: 12,418,908 (GRCm39) Y4C probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73,172,720 (GRCm39) missense probably benign 0.00
IGL00488:Dnah6 APN 6 73,063,190 (GRCm39) missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73,172,744 (GRCm39) missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73,189,417 (GRCm39) critical splice donor site probably null
IGL00756:Dnah6 APN 6 73,100,754 (GRCm39) missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73,133,333 (GRCm39) missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73,010,509 (GRCm39) splice site probably benign
IGL00972:Dnah6 APN 6 73,060,140 (GRCm39) splice site probably benign
IGL00975:Dnah6 APN 6 73,150,373 (GRCm39) missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73,051,764 (GRCm39) splice site probably benign
IGL01307:Dnah6 APN 6 73,042,708 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73,150,439 (GRCm39) missense probably benign 0.01
IGL01362:Dnah6 APN 6 73,069,161 (GRCm39) missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73,051,731 (GRCm39) missense probably benign 0.10
IGL01559:Dnah6 APN 6 73,001,235 (GRCm39) critical splice donor site probably null
IGL01622:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73,052,785 (GRCm39) missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73,053,643 (GRCm39) nonsense probably null
IGL01736:Dnah6 APN 6 73,165,360 (GRCm39) missense probably benign 0.06
IGL01825:Dnah6 APN 6 73,042,759 (GRCm39) missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73,112,784 (GRCm39) missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73,009,552 (GRCm39) missense probably benign 0.04
IGL01935:Dnah6 APN 6 73,037,126 (GRCm39) missense probably benign
IGL02126:Dnah6 APN 6 73,080,149 (GRCm39) missense probably benign 0.01
IGL02191:Dnah6 APN 6 72,994,780 (GRCm39) missense probably benign 0.00
IGL02293:Dnah6 APN 6 73,110,633 (GRCm39) splice site probably benign
IGL02316:Dnah6 APN 6 73,145,894 (GRCm39) missense probably benign 0.19
IGL02339:Dnah6 APN 6 73,078,881 (GRCm39) missense probably benign 0.00
IGL02380:Dnah6 APN 6 73,053,623 (GRCm39) missense probably benign 0.12
IGL02458:Dnah6 APN 6 73,004,431 (GRCm39) missense probably benign 0.43
IGL02499:Dnah6 APN 6 72,998,210 (GRCm39) missense probably benign 0.12
IGL02652:Dnah6 APN 6 73,072,087 (GRCm39) missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73,098,806 (GRCm39) missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73,185,582 (GRCm39) missense probably benign 0.03
IGL02875:Dnah6 APN 6 73,115,698 (GRCm39) missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73,009,570 (GRCm39) missense probably benign 0.01
IGL02989:Dnah6 APN 6 73,046,403 (GRCm39) missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73,126,123 (GRCm39) missense probably benign 0.19
IGL03135:Dnah6 APN 6 73,121,987 (GRCm39) missense probably benign 0.00
IGL03145:Dnah6 APN 6 73,018,037 (GRCm39) missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73,121,683 (GRCm39) missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73,030,630 (GRCm39) splice site probably benign
IGL03286:Dnah6 APN 6 73,060,068 (GRCm39) missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73,052,833 (GRCm39) missense probably benign 0.15
P0025:Dnah6 UTSW 6 73,140,487 (GRCm39) missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73,042,738 (GRCm39) missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73,185,624 (GRCm39) missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73,078,863 (GRCm39) missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73,091,565 (GRCm39) missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73,037,243 (GRCm39) missense probably benign 0.02
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73,015,717 (GRCm39) splice site probably benign
R0164:Dnah6 UTSW 6 73,165,518 (GRCm39) splice site probably benign
R0165:Dnah6 UTSW 6 72,998,306 (GRCm39) missense probably benign 0.01
R0183:Dnah6 UTSW 6 73,059,906 (GRCm39) missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73,046,403 (GRCm39) missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73,136,098 (GRCm39) missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73,150,541 (GRCm39) missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73,046,382 (GRCm39) splice site probably benign
R0345:Dnah6 UTSW 6 72,998,240 (GRCm39) missense probably benign 0.12
R0357:Dnah6 UTSW 6 73,165,342 (GRCm39) missense probably benign
R0362:Dnah6 UTSW 6 73,185,592 (GRCm39) missense probably benign 0.06
R0377:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73,060,107 (GRCm39) missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73,021,757 (GRCm39) missense probably benign 0.15
R0639:Dnah6 UTSW 6 72,999,395 (GRCm39) missense probably benign 0.02
R0673:Dnah6 UTSW 6 73,100,794 (GRCm39) missense probably benign 0.01
R0690:Dnah6 UTSW 6 73,106,457 (GRCm39) missense probably benign 0.01
R0708:Dnah6 UTSW 6 73,189,605 (GRCm39) missense probably benign 0.05
R0711:Dnah6 UTSW 6 73,064,585 (GRCm39) missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73,012,276 (GRCm39) missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73,101,740 (GRCm39) missense probably benign 0.00
R0972:Dnah6 UTSW 6 73,136,176 (GRCm39) missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73,121,948 (GRCm39) missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73,136,118 (GRCm39) missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73,101,692 (GRCm39) missense probably benign 0.22
R1301:Dnah6 UTSW 6 73,185,528 (GRCm39) critical splice donor site probably null
R1341:Dnah6 UTSW 6 73,168,602 (GRCm39) missense probably benign 0.09
R1509:Dnah6 UTSW 6 73,004,425 (GRCm39) missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73,026,031 (GRCm39) missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73,128,536 (GRCm39) missense probably benign
R1557:Dnah6 UTSW 6 73,026,114 (GRCm39) nonsense probably null
R1591:Dnah6 UTSW 6 73,053,583 (GRCm39) missense probably benign 0.01
R1602:Dnah6 UTSW 6 73,044,452 (GRCm39) missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73,121,946 (GRCm39) missense probably benign 0.09
R1616:Dnah6 UTSW 6 73,077,095 (GRCm39) missense probably benign 0.10
R1643:Dnah6 UTSW 6 73,021,735 (GRCm39) missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73,132,279 (GRCm39) missense probably benign 0.18
R1655:Dnah6 UTSW 6 73,182,715 (GRCm39) missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1665:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1675:Dnah6 UTSW 6 73,106,523 (GRCm39) missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73,021,744 (GRCm39) missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73,137,965 (GRCm39) missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73,001,941 (GRCm39) missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73,158,780 (GRCm39) missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73,077,071 (GRCm39) missense probably benign 0.00
R1897:Dnah6 UTSW 6 73,158,745 (GRCm39) missense probably benign 0.30
R1951:Dnah6 UTSW 6 73,061,704 (GRCm39) nonsense probably null
R1978:Dnah6 UTSW 6 73,098,953 (GRCm39) missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73,072,027 (GRCm39) missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73,069,175 (GRCm39) missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73,044,449 (GRCm39) missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73,150,402 (GRCm39) missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73,004,405 (GRCm39) missense probably benign
R2041:Dnah6 UTSW 6 73,050,422 (GRCm39) missense probably damaging 1.00
R2068:Dnah6 UTSW 6 72,998,165 (GRCm39) missense probably benign 0.23
R2114:Dnah6 UTSW 6 73,121,018 (GRCm39) missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73,026,149 (GRCm39) missense probably benign 0.32
R2163:Dnah6 UTSW 6 73,066,729 (GRCm39) splice site probably null
R2193:Dnah6 UTSW 6 73,115,623 (GRCm39) missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73,077,068 (GRCm39) missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73,090,564 (GRCm39) missense probably benign 0.15
R2292:Dnah6 UTSW 6 72,998,092 (GRCm39) missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73,133,404 (GRCm39) missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73,068,950 (GRCm39) splice site probably null
R2436:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.05
R2847:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R2848:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R3033:Dnah6 UTSW 6 73,150,333 (GRCm39) missense probably benign 0.03
R3429:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73,009,616 (GRCm39) missense probably benign 0.21
R3811:Dnah6 UTSW 6 73,168,481 (GRCm39) missense probably benign 0.00
R3852:Dnah6 UTSW 6 73,104,910 (GRCm39) missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73,066,575 (GRCm39) nonsense probably null
R4246:Dnah6 UTSW 6 73,106,431 (GRCm39) missense probably benign 0.00
R4367:Dnah6 UTSW 6 73,126,467 (GRCm39) missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73,095,009 (GRCm39) missense probably benign 0.01
R4405:Dnah6 UTSW 6 73,106,274 (GRCm39) missense probably benign 0.00
R4420:Dnah6 UTSW 6 73,168,462 (GRCm39) missense probably benign
R4486:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73,155,399 (GRCm39) missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73,169,388 (GRCm39) missense probably benign
R4573:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73,129,695 (GRCm39) missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73,106,643 (GRCm39) missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73,047,580 (GRCm39) missense probably benign
R4653:Dnah6 UTSW 6 73,050,440 (GRCm39) missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73,014,671 (GRCm39) missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73,169,405 (GRCm39) missense probably benign 0.04
R4712:Dnah6 UTSW 6 73,001,995 (GRCm39) critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73,106,513 (GRCm39) missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73,072,057 (GRCm39) missense probably benign 0.11
R4792:Dnah6 UTSW 6 73,066,651 (GRCm39) missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4817:Dnah6 UTSW 6 72,999,407 (GRCm39) missense probably benign 0.02
R4830:Dnah6 UTSW 6 73,021,745 (GRCm39) missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73,098,771 (GRCm39) missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73,169,659 (GRCm39) intron probably benign
R4948:Dnah6 UTSW 6 73,030,672 (GRCm39) missense probably benign 0.00
R4953:Dnah6 UTSW 6 73,165,366 (GRCm39) missense probably benign 0.19
R5000:Dnah6 UTSW 6 73,121,798 (GRCm39) missense probably benign 0.26
R5036:Dnah6 UTSW 6 73,021,674 (GRCm39) missense probably benign
R5044:Dnah6 UTSW 6 73,014,605 (GRCm39) missense probably benign 0.41
R5143:Dnah6 UTSW 6 73,158,744 (GRCm39) missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73,172,617 (GRCm39) missense probably benign
R5186:Dnah6 UTSW 6 73,044,410 (GRCm39) missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73,172,715 (GRCm39) missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73,090,471 (GRCm39) missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73,104,844 (GRCm39) critical splice donor site probably null
R5330:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73,189,603 (GRCm39) missense probably benign
R5343:Dnah6 UTSW 6 73,189,599 (GRCm39) missense probably benign
R5375:Dnah6 UTSW 6 73,100,838 (GRCm39) missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73,014,598 (GRCm39) missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73,037,121 (GRCm39) missense probably benign 0.00
R5455:Dnah6 UTSW 6 73,052,717 (GRCm39) missense probably benign 0.00
R5458:Dnah6 UTSW 6 73,063,168 (GRCm39) missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73,069,140 (GRCm39) missense probably benign 0.04
R5484:Dnah6 UTSW 6 73,069,099 (GRCm39) missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73,167,402 (GRCm39) missense probably null 0.00
R5527:Dnah6 UTSW 6 73,136,212 (GRCm39) missense probably benign
R5541:Dnah6 UTSW 6 73,169,971 (GRCm39) missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73,128,672 (GRCm39) missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73,126,508 (GRCm39) missense probably damaging 1.00
R5689:Dnah6 UTSW 6 72,998,210 (GRCm39) missense probably benign 0.12
R5966:Dnah6 UTSW 6 73,037,262 (GRCm39) missense probably benign 0.00
R5980:Dnah6 UTSW 6 73,158,705 (GRCm39) missense probably benign 0.01
R6049:Dnah6 UTSW 6 73,063,149 (GRCm39) missense probably benign 0.38
R6092:Dnah6 UTSW 6 73,091,680 (GRCm39) missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73,165,477 (GRCm39) missense probably benign 0.16
R6279:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73,063,200 (GRCm39) missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73,168,588 (GRCm39) missense probably benign 0.02
R6394:Dnah6 UTSW 6 73,132,401 (GRCm39) nonsense probably null
R6470:Dnah6 UTSW 6 73,051,569 (GRCm39) missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73,051,687 (GRCm39) missense probably benign 0.05
R6545:Dnah6 UTSW 6 73,021,715 (GRCm39) missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73,150,516 (GRCm39) missense probably benign 0.02
R6609:Dnah6 UTSW 6 73,030,678 (GRCm39) missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73,012,263 (GRCm39) splice site probably null
R6640:Dnah6 UTSW 6 73,001,276 (GRCm39) missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73,115,743 (GRCm39) missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73,014,532 (GRCm39) missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73,110,591 (GRCm39) missense probably benign 0.29
R6845:Dnah6 UTSW 6 73,110,525 (GRCm39) missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73,189,505 (GRCm39) missense probably benign 0.00
R6918:Dnah6 UTSW 6 73,158,738 (GRCm39) nonsense probably null
R6929:Dnah6 UTSW 6 73,021,756 (GRCm39) missense probably damaging 0.96
R6981:Dnah6 UTSW 6 72,998,161 (GRCm39) missense probably benign 0.00
R7065:Dnah6 UTSW 6 73,064,545 (GRCm39) missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73,112,663 (GRCm39) missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73,158,688 (GRCm39) critical splice donor site probably null
R7203:Dnah6 UTSW 6 73,150,528 (GRCm39) missense probably benign 0.00
R7315:Dnah6 UTSW 6 73,061,743 (GRCm39) missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73,121,705 (GRCm39) nonsense probably null
R7387:Dnah6 UTSW 6 73,189,595 (GRCm39) nonsense probably null
R7388:Dnah6 UTSW 6 73,169,300 (GRCm39) missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73,189,475 (GRCm39) missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73,104,887 (GRCm39) missense probably benign 0.04
R7524:Dnah6 UTSW 6 73,095,082 (GRCm39) missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73,004,423 (GRCm39) missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73,126,413 (GRCm39) missense probably benign 0.01
R7604:Dnah6 UTSW 6 73,069,151 (GRCm39) missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73,072,189 (GRCm39) missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73,101,742 (GRCm39) missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73,146,063 (GRCm39) splice site probably null
R7735:Dnah6 UTSW 6 73,046,412 (GRCm39) missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73,002,703 (GRCm39) missense probably benign 0.41
R7829:Dnah6 UTSW 6 73,104,902 (GRCm39) nonsense probably null
R7904:Dnah6 UTSW 6 73,112,450 (GRCm39) splice site probably null
R8034:Dnah6 UTSW 6 73,106,208 (GRCm39) missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73,137,896 (GRCm39) missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73,002,769 (GRCm39) missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73,037,208 (GRCm39) missense probably benign 0.16
R8206:Dnah6 UTSW 6 73,014,549 (GRCm39) nonsense probably null
R8214:Dnah6 UTSW 6 73,021,711 (GRCm39) missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73,145,810 (GRCm39) critical splice donor site probably null
R8273:Dnah6 UTSW 6 73,172,664 (GRCm39) missense probably benign 0.00
R8273:Dnah6 UTSW 6 73,053,582 (GRCm39) missense probably benign 0.31
R8331:Dnah6 UTSW 6 73,001,983 (GRCm39) missense probably benign 0.10
R8350:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8428:Dnah6 UTSW 6 73,051,634 (GRCm39) missense probably benign 0.15
R8447:Dnah6 UTSW 6 73,115,757 (GRCm39) missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8517:Dnah6 UTSW 6 73,155,440 (GRCm39) missense probably benign 0.16
R8523:Dnah6 UTSW 6 73,072,171 (GRCm39) missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73,145,850 (GRCm39) missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73,052,873 (GRCm39) intron probably benign
R8737:Dnah6 UTSW 6 73,044,428 (GRCm39) missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73,156,811 (GRCm39) missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73,042,756 (GRCm39) missense probably benign
R8809:Dnah6 UTSW 6 73,009,546 (GRCm39) missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73,104,937 (GRCm39) missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73,121,156 (GRCm39) critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 72,998,131 (GRCm39) missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73,155,481 (GRCm39) missense probably benign 0.05
R8973:Dnah6 UTSW 6 73,121,734 (GRCm39) missense probably benign 0.39
R9053:Dnah6 UTSW 6 73,061,640 (GRCm39) missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.00
R9077:Dnah6 UTSW 6 73,121,029 (GRCm39) nonsense probably null
R9102:Dnah6 UTSW 6 73,044,469 (GRCm39) missense probably benign
R9106:Dnah6 UTSW 6 73,121,752 (GRCm39) missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73,037,186 (GRCm39) missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73,098,882 (GRCm39) missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73,121,924 (GRCm39) missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73,121,688 (GRCm39) nonsense probably null
R9200:Dnah6 UTSW 6 73,004,497 (GRCm39) missense probably benign 0.06
R9265:Dnah6 UTSW 6 73,060,040 (GRCm39) missense probably benign 0.02
R9368:Dnah6 UTSW 6 72,998,261 (GRCm39) missense probably benign 0.22
R9378:Dnah6 UTSW 6 73,189,513 (GRCm39) missense probably benign
R9439:Dnah6 UTSW 6 73,012,330 (GRCm39) missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73,119,299 (GRCm39) missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73,115,750 (GRCm39) missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73,168,589 (GRCm39) missense probably benign 0.00
RF002:Dnah6 UTSW 6 73,078,872 (GRCm39) missense probably benign
RF020:Dnah6 UTSW 6 73,095,040 (GRCm39) missense probably benign 0.00
W0251:Dnah6 UTSW 6 73,155,501 (GRCm39) missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73,168,483 (GRCm39) missense probably benign 0.01
X0025:Dnah6 UTSW 6 73,014,656 (GRCm39) missense probably damaging 1.00
Z1176:Dnah6 UTSW 6 73,110,542 (GRCm39) missense probably benign
Z1176:Dnah6 UTSW 6 73,064,766 (GRCm39) missense possibly damaging 0.79
Z1177:Dnah6 UTSW 6 73,009,509 (GRCm39) missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 72,998,220 (GRCm39) missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73,132,255 (GRCm39) missense possibly damaging 0.92
Z1177:Dnah6 UTSW 6 73,018,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTCTGTAGACCCTGGG -3'
(R):5'- CCCAGATTGTAAACATTGGAGGAG -3'

Sequencing Primer
(F):5'- TAGACCCTGGGAGCCACAAAG -3'
(R):5'- TTGTAAACATTGGAGGAGACCAGC -3'
Posted On 2021-11-19