Mutagenetix > Incidental Mutation

Incidental Mutation 'R9049:Muc5ac'

688243

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9049 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 141808975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 2008 (I2008L)

Ref Sequence

ENSEMBL: ENSMUSP00000122353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041924

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000155534
AA Change: I2008L

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: I2008L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163321

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,061,038	Y323C	probably benign	Het
3110009E18Rik	A	G	1: 120,188,170	I118V	probably null	Het
3110043O21Rik	A	G	4: 35,192,964	I455T	unknown	Het
Abcc9	A	G	6: 142,682,932	L362P	probably damaging	Het
Adam7	C	A	14: 68,525,225	V184F	probably benign	Het
Adgre4	T	C	17: 55,785,094	I118T	probably benign	Het
Akap9	T	C	5: 4,064,597	L3292P		Het
Akr1b10	A	G	6: 34,396,626	E308G	possibly damaging	Het
Ash1l	T	C	3: 89,007,364	V1767A	probably benign	Het
Bpifb3	C	A	2: 153,925,890	N294K	probably benign	Het
Bpifb5	A	G	2: 154,228,176	N182S	probably benign	Het
Camkmt	A	G	17: 85,402,484	I205M	possibly damaging	Het
Ccdc88b	C	T	19: 6,849,074	R1091Q	probably benign	Het
Cfap58	A	T	19: 48,026,718		probably null	Het
Clca1	T	A	3: 145,027,382	I122L	probably benign	Het
Col6a3	T	A	1: 90,779,344	S2623C	unknown	Het
Cpne5	A	G	17: 29,160,358	S484P	probably damaging	Het
Cyp4f39	T	A	17: 32,486,991	L352Q	probably damaging	Het
Dcun1d1	T	C	3: 35,897,849	N183D	probably benign	Het
Dgkg	A	G	16: 22,600,588	V54A	probably benign	Het
Dnah12	T	A	14: 26,722,120	D561E	probably benign	Het
Dnah6	A	C	6: 73,142,292	L1536R	probably damaging	Het
Gm15448	T	A	7: 3,816,891	T676S	unknown	Het
Gm21834	G	A	17: 57,741,831	T130I	possibly damaging	Het
Hectd4	T	A	5: 121,313,892	V434E	possibly damaging	Het
Htr3a	C	A	9: 48,899,787	V459L	probably damaging	Het
Lonp2	T	C	8: 86,709,107	V657A	probably benign	Het
Mdfi	C	A	17: 47,824,554	V84L	probably damaging	Het
Mdm1	C	T	10: 118,146,700	T80M	probably benign	Het
Nomo1	A	G	7: 46,066,173	D681G	probably benign	Het
Olfr1030	A	G	2: 85,983,891	E17G	possibly damaging	Het
Olfr127	G	A	17: 37,903,873	W109*	probably null	Het
Olfr193	T	G	16: 59,110,400	D70A	probably damaging	Het
Olfr366	C	G	2: 37,219,947	H153D	probably damaging	Het
Olfr406	A	G	11: 74,270,289	K300R	possibly damaging	Het
Olfr860	T	C	9: 19,845,749	Y290C	probably damaging	Het
Olfr979	G	T	9: 40,000,623	N201K	possibly damaging	Het
Pip5k1c	C	A	10: 81,316,876		probably benign	Het
Pipox	A	G	11: 77,881,554	I330T	probably damaging	Het
Pld3	C	T	7: 27,535,868	V312M	possibly damaging	Het
Pnisr	T	A	4: 21,854,391	W12R	unknown	Het
Polr3e	A	G	7: 120,939,239	K410R	probably benign	Het
Ppif	G	T	14: 25,694,412	V61L	possibly damaging	Het
Pramel5	T	C	4: 144,273,916	N30S	probably benign	Het
Prex2	T	G	1: 11,185,906	L1167R	probably damaging	Het
Prkacb	A	T	3: 146,755,763		probably benign	Het
Prl3a1	T	A	13: 27,276,184	L217H	probably damaging	Het
Prop1	G	C	11: 50,952,121	Q80E	probably damaging	Het
Psma1	T	C	7: 114,266,529	I214V	probably benign	Het
Ptgfr	T	A	3: 151,835,767	I35F	probably benign	Het
Rcvrn	A	T	11: 67,695,742	Y109F	probably benign	Het
Repin1	A	G	6: 48,597,712	D525G	possibly damaging	Het
Slc12a2	A	T	18: 57,921,791	R835*	probably null	Het
Sqle	T	C	15: 59,317,862	F118L	probably benign	Het
Stard9	A	T	2: 120,679,937	Y333F	probably benign	Het
Tbc1d16	G	A	11: 119,209,264	R95C	probably damaging	Het
Tln1	C	A	4: 43,549,786	E542*	probably null	Het
Tmem161b	G	T	13: 84,294,635	A407S	probably benign	Het
Tnc	G	T	4: 64,000,010	D1221E	possibly damaging	Het
Tnks	T	C	8: 34,841,778	K1109R	probably damaging	Het
Tpp2	T	C	1: 43,953,342	V194A	possibly damaging	Het
Ust	G	A	10: 8,307,454	Q162*	probably null	Het
Utp15	T	C	13: 98,259,270	Y68C	probably damaging	Het
Vcan	A	T	13: 89,678,105	H3193Q	probably damaging	Het
Vmn2r55	T	C	7: 12,684,981	Y4C	probably damaging	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9287:Muc5ac	UTSW	7	141807889	missense	probably damaging	0.99
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9454:Muc5ac	UTSW	7	141808694	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GGAAAGACCAGCACCATCTCT -3'
(R):5'- GCTGGCCTTTCCTGTATTGG -3'

Sequencing Primer
(F):5'- GAAAGACCAGCACCATCTCTACAAC -3'
(R):5'- AGAGATGGTGCTGGTCTTTCC -3'

Posted On

2021-11-19